Labshake search
Citations for Charles River Labs :
301 - 341 of 341 citations for Human G protein coupled receptor 42 GPR42 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Experiments were conducted on Sprague Dawley (nerve stimulation) or Lewis (chronic nerve electrophysiology recordings) female rats ∼150-200 g in weight (Charles River, UK). Rats were group-housed in individually ventilated cages with ad libitum access to food and water for the duration of the study.
-
bioRxiv - Neuroscience 2022Quote: ... They had unlimited chow (Rodent 5075, 18% protein, 4.5% fat, Charles River Laboratories) until 2 days before the commencement of food self-administration training ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: Male and female Wistar rats (n=10, weighing 200-250 g at the time of arrival, and obtained from Charles River (Sulzfeld, Germany)) were used for breeding ...
-
bioRxiv - Neuroscience 2023Quote: ... Experiments were performed in adult female C57B6L/6 mice (2 to 3 months of age, 20 to 25.1 g) (Charles River, Strain code:027). All procedures were performed under general anesthesia (20 mg/kg ketamine ...
-
bioRxiv - Physiology 2023Quote: Fifteen sexually mature female CD-1 mice (sacrificial age ∼ 34 weeks; mass = 44.1 ± 7.9 g) were obtained (Charles River Laboratories, Senneville, QC, Canada) with approval from the University of Guelph’s Animal Care Committee and all protocols followed CCAC guidelines ...
-
bioRxiv - Neuroscience 2024Quote: Female Sprague-Dawley rats (∼200 g and 9 weeks on arrival, witnesses/controls) and male Sprague-Dawley rats (∼250 g on arrival, intruders) were obtained from Charles River (Durham, NC) while male Long-Evans retired breeders (600-800 g ...
-
bioRxiv - Pathology 2024Quote: ... aged 12–14 weeks) (Harlan, Venray, The Netherlands) or spontaneously hypertensive male Wistar-Kyoto (280–320 g, aged 12–14 weeks) (Charles River, Sulzfeld, Germany) were randomly allocated to their respective control group after an acclimatization period ...
-
bioRxiv - Immunology 2024Quote: ... Female BALB/c mice of 11-16 weeks with body weight between 19 and 24 g were used for the experiments (Charles River, Sulzfeld, Germany). The local animal facility environment had a temperature of 22°C and a humidity of 45-60% followed a 12-hour light/dark cycle ...
-
bioRxiv - Biophysics 2022Quote: ... 100 µL of influenza solution (viral protein concentration from Charles River ∼ 0.2 mg/mL) was mixed in 400 µL of diluted Texas Red-DHPE suspension in HB buffer and incubated at room temperature in the dark for 2 h on a rocker ...
-
bioRxiv - Physiology 2022Quote: ... Mice expressing the cre recombinase under the control of the human cytomegalovirus minimal promoter (CMV-cre+/-) were purchased from Charles River Laboratories (Sulzfeld ...
-
bioRxiv - Developmental Biology 2022Quote: ... was used to identify potential binding partners for multimerised human CACHD1 ectodomain (prepared as above) and was performed by Charles River Discovery Research Services UK Limited (formerly Retrogenix Limited ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The effects of PF-07304814 and PF-00835231 on human red blood cell hemolysis and plasma flocculation were evaluated in GLP-compliant studies conducted by Charles River Laboratories on behalf of Pfizer Inc ...
-
bioRxiv - Immunology 2023Quote: ... Nephrectomies were performed on 12 human C5aR knock-in male mice aged 7-10 weeks by a surgeon contracted from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: Experiments were carried out with male Lister Hooded rats (3 months old, 250-300 g at the beginning of the experiments) provided by an authorized supplier (Charles River Laboratories, Barcelona, Spain). Upon their arrival at Pablo de Olavide Animal House (Seville ...
-
bioRxiv - Physiology 2020Quote: White fat adipocytes were isolated from the epididymal fat pads of male CD-1 mice (fed ad libitum, 12 hr. dark/light cycle, weight 25 – 35 g; Charles River Laboratory, Kent, UK). Adipocytes were isolated by collagenase digestion as previously described (Bentley et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... male Spontaneously Hypertensive Rats (SHR) (n=15) and Wistar Kyoto rats (WKY) (n=13) (50–60 g on arrival, Charles River Laboratories, Wilmington MA) were used in the present study ...
-
bioRxiv - Microbiology 2022Quote: ... Endochrome-K kit (Charles River) was used ...
-
bioRxiv - Bioengineering 2021Quote: Human embryonic kidney cells 293 stably expressing human hyperpolarization-gated cyclic nucleotide-sensitive cation channel 1 (HEK-HCN1) were obtained from Charles River (CT6114). Cells were cultured and maintained according to the online protocol by Charles River ...
-
bioRxiv - Genomics 2021Quote: ... Pregnant mare serum gonadotropin (5 units) and human chorionic gonadotropin (5 units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories) with a 48-h interval ...
-
bioRxiv - Cell Biology 2023Quote: Tumors were generated by intradermal injection of 5000 human metastatic melanoma cells (1205Lu) in anaesthetized Crl:NU(NCr)-Foxn1nu (athymic nude mice; Charles River, Rockville MD). Cells stably expressing GFP-cGas and mScarlet NLS were injected in a 1:1 mixture of Matrigel and minimal essential medium (Gibco ...
-
bioRxiv - Immunology 2022Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Plant Biology 2021Quote: Antibodies from guinea pig immunization with this purified protein product were obtained from Charles River biologics (USA).
-
bioRxiv - Microbiology 2021Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Physiology 2022Quote: ... Adult male Sprague-Dawley rats (200-225 g) or adult male C57BL/6J mice (63-70 days; purchased from Charles river UK Ltd, Kent, UK) were killed by cervical dislocation and kidney tissue slices were obtained as previously described (11).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The animal experiments adhered to national guidelines and were approved by the local ethics committee of the Centre de Recherche du CHUM (CIPA, Montreal, QC, Canada). Secondary biliary cirrhosis was induced in male Sprague-Dawley rats (ca. 220 g) (Charles River Laboratories, St. Constant, QC, Canada) by surgical bile duct ligation (BDL) ...
-
bioRxiv - Pathology 2022Quote: ... The pregnant mare serum gonadotropin (5 units) and the human chorionic gonadotropin (5 units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories, Kanagawa, Japan) with a 48h interval ...
-
bioRxiv - Developmental Biology 2021Quote: Pregnant mare serum gonadotropin (five units) and human chorionic gonadotropin (five units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories, Kanagawa, Japan) at a 48-h interval ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant proteins were tested for LPS content by the chromogenic Limulus amebocyte lysate assay (Endochrome; Charles River), and the endotoxin content was less than 0.01 U per microgram of recombinant proteins.
-
bioRxiv - Bioengineering 2023Quote: ... For the immunogenic protein challenge experiments 9 week old female Balb/c mice were purchased from Charles River Laboratory.
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Molecular Biology 2024Quote: In vivo immunogenicity of gB protein in combination with adjuvants was evaluated in 6–8 week old BALB/c mice (Charles River) at Aragen Bioscience (Morgan Hill ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...
-
bioRxiv - Microbiology 2021Quote: ... Endotoxin levels were measured by the Limulus Amebocyte Lysate (LAL) kit (Charles River) and determined to be <0.8 EU/ml which is below the 5 EU/kg body weight set for intraperitoneal injection66 ...
-
bioRxiv - Bioengineering 2023Quote: ... The plate-reader based LAL assay was performed with the Endosafe Endochrome-K kit (Charles River, #R1708K), where a control standard endotoxin (CSE ...
-
bioRxiv - Biochemistry 2021Quote: ... all protein samples were brought to a final volume of 200 μL and the LPS content was measured using a commercial kit from Charles River Endosafe (R160) ...
-
bioRxiv - Immunology 2019Quote: ... The endotoxin content in the purified BLP was assessed by Limulus amebocyte lysate (LAL) assay using Endochrome – KTM kit (Charles River, SC, USA) as per manufacturer’s instructions.