Labshake search
Citations for Charles River Labs :
1 - 50 of 312 citations for Guanine Nucleotide Binding Protein G Protein Alpha Activating Activity Polypeptide O GNAO1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: Antibodies from guinea pig immunization with this purified protein product were obtained from Charles River biologics (USA).
-
bioRxiv - Pathology 2020Quote: Samples collected at preinfection and weekly post-infection until necropsy were tested for detection of binding IgG antibodies against SARS-CoV-2 nucleoprotein (NP) by MFIA COVID-Plex from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... They had unlimited chow (Rodent 5075, 18% protein, 4.5% fat, Charles River Laboratories) until 2 days before the commencement of food self-administration training ...
-
bioRxiv - Biophysics 2022Quote: ... 100 µL of influenza solution (viral protein concentration from Charles River ∼ 0.2 mg/mL) was mixed in 400 µL of diluted Texas Red-DHPE suspension in HB buffer and incubated at room temperature in the dark for 2 h on a rocker ...
-
bioRxiv - Immunology 2022Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Microbiology 2021Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Neuroscience 2023Quote: ... female (150-175 g) and male (225-250 g) Wistar rats (Charles River Laboratories ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant proteins were tested for LPS content by the chromogenic Limulus amebocyte lysate assay (Endochrome; Charles River), and the endotoxin content was less than 0.01 U per microgram of recombinant proteins.
-
bioRxiv - Molecular Biology 2021Quote: The administration of 2′-O-MOE gapmer was performed in female FVB mice (Charles River Laboratories, Wilmington, MA), 8 weeks of age ...
-
bioRxiv - Bioengineering 2021Quote: Human embryonic kidney cells 293 stably expressing human hyperpolarization-gated cyclic nucleotide-sensitive cation channel 1 (HEK-HCN1) were obtained from Charles River (CT6114). Cells were cultured and maintained according to the online protocol by Charles River ...
-
bioRxiv - Bioengineering 2023Quote: ... For the immunogenic protein challenge experiments 9 week old female Balb/c mice were purchased from Charles River Laboratory.
-
bioRxiv - Neuroscience 2022Quote: ... Male (300-350 g) and female (200-250 g) Sprague-Dawley rats (Charles River, MA) were pair-housed upon arrival and given ad libitum access to water and chow and maintained on a 12-hour light/dark cycle (n = 8 male rats/9 electrodes ...
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Neuroscience 2023Quote: Adult male (250-350 g) and female (200-300 g) Wistar rats were obtained from Charles River Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Biochemistry 2023Quote: ... 25-30 g (Charles River Laboratories, UK), were killed by CO2 asphyxiation and the hemi-diaphragm muscle and attached phrenic nerve isolated and attached to a custom tissue holder/electrode (Emka Technologies ...
-
bioRxiv - Bioengineering 2022Quote: ... ∼250 g Lewis rats (Charles River UK) were housed in groups of 5 and provided ad libitum access to food and water for a minimum of 7 days prior to surgical procedures ...
-
bioRxiv - Bioengineering 2023Quote: ... body weight 250-400 g (Charles River Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Molecular Biology 2024Quote: In vivo immunogenicity of gB protein in combination with adjuvants was evaluated in 6–8 week old BALB/c mice (Charles River) at Aragen Bioscience (Morgan Hill ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Adult male (200-225 g) and female (150-175 g) Sprague-Dawley rats (Charles River Laboratories, Montréal, Quebec, Canada) were housed 2 per cage in a climate-controlled (22±1°C ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...
-
bioRxiv - Bioengineering 2021Quote: In vivo skeletal muscle repair studies were conducted over 12 weeks using a total of 21 female Lewis rats (11–14 weeks old with a mean bodyweight of 198.4 g – 3.5 g) (Charles River Laboratories) split into three groups ...
-
bioRxiv - Neuroscience 2021Quote: ... 250 to 350 g in mass (Charles River), were used for combined behavioral ...
-
bioRxiv - Pathology 2019Quote: Male Sprague–Dawley rats (Charles River; ~400 g) were sacrificed and perfused with cold heparinized Hanks balanced salt solution (HBSS) ...
-
bioRxiv - Microbiology 2021Quote: Seven- to eight-week-old outbred female CD1 (CD-1 IGS) Swiss mice (27 g to 30 g ea.) were obtained from Charles River Labs ...
-
bioRxiv - Cancer Biology 2021Quote: ... weight at 20–25 g) and Male athymic nude mice (6~7 weeks old; weight at 20–25 g) were purchased from Charles River and Envigo (Indianapolis ...
-
bioRxiv - Molecular Biology 2019Quote: Thirty-two ovariectomized and 10 sham-operated 6-month-old female Sprague Dawley rats (ranging in weight from 270 g to 356 g) were sourced from Charles River Laboratories ...
-
bioRxiv - Immunology 2019Quote: ... 30 male Sprague Dawley rats (250 to 350 g) and10 male Lewis rats (250 to 350 g) were obtained from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... Adult male CF No 1 (CF-1) albino mice (18 - 30 g) and adult male Sprague-Dawley rats (100 -150 g) were obtained from Charles River’s facility in Kingston ...
-
bioRxiv - Neuroscience 2022Quote: ... experiment 2 used 17 males weighing 225-250 g and 17 females weighing 150-175 g on arrival from Charles River Raleigh (Area R06 ...
-
bioRxiv - Bioengineering 2023Quote: Nineteen-week-old ZDSD male rats (‘‘diabetic”; n=20, mean weight = 478 g) and LSD (‘‘control”; n=20, mean weight = 518 g) were purchased from Charles River and used in this study ...
-
bioRxiv - Neuroscience 2023Quote: Subjects were male (200-225 g upon arrival) and female (175-200 g upon arrival) adult Long-Evans rats acquired from Charles River Laboratories (Wilmington ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: Three separate cohorts of adult male and female Wistar rats (initial weights M: 253-306 g; F: 146-206 g Charles River, NC) were obtained at 8 weeks of age ...
-
bioRxiv - Pathology 2019Quote: ... weighing 275-300 g (strain code: 004; Charles River), were ordered and acclimated to the environment for one-week post arrival to the VAMC ...
-
Regulation of skeletal muscle metabolism and contraction performance via teneurin-latrophilin actionbioRxiv - Physiology 2021Quote: ... Male adult Wistar rats (∼250 g) (Charles River, USA) were used for the functional positron emission tomography (fPET ...
-
bioRxiv - Neuroscience 2021Quote: ... male Sprague-Dawley rats (180-220 g, Charles River) were anesthetized with a mix of ketamine (5 mg/100 g ...
-
bioRxiv - Neuroscience 2020Quote: ... Male Sprague Dawley rats (Charles River, 250-400 g) were used for implanting Argo microwire arrays ...
-
bioRxiv - Molecular Biology 2021Quote: ... ~20 g female CD-1 mice (Charles River Labs) housed in standard shoebox cages at 5 mice/cage ...
-
bioRxiv - Neuroscience 2023Quote: ... nude male rats (220 g, n= 18; Charles River) were used (5 sham-treated animals ...
-
bioRxiv - Neuroscience 2023Quote: 32 Adult Lister-Hooded rats (∽400 g, Charles River Laboratories ...
-
bioRxiv - Cell Biology 2024Quote: ... weighing 30-34 g (Charles River Laboratories, Margate, UK), were used ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Adult male and female Wistar rats (males 200–250 g, females 175–225 g, 8-9 weeks of age) were purchased from Charles River (Raleigh, NC). Rats were housed with a rat of the same sex in a climate-controlled vivarium on a reversed 12 h light-dark cycle (light off at 7 AM) ...
-
bioRxiv - Neuroscience 2020Quote: Experiments were performed with 10 weeks-old male and female C57BL/6J mice (26±4 g and 20±4 g, respectively; Charles River, L’Arbresle, France). Animals were housed according to a 12 h light-dark cycle ...
-
bioRxiv - Neuroscience 2023Quote: Experiments were performed with ten weeks-old male and female C57BL/6J mice (26±4 g and 20±4 g, respectively; JAX:006362; Charles River, L’Arbresle, France). Male and female mice were group-housed at 5 per cage ...
-
Micro topographical instruction of bacterial attachment, biofilm formation and in vivo host responsebioRxiv - Microbiology 2022Quote: ... into 19–22 g female BALB/c mice (Charles River) with the patterned side facing upwards to the skin surface ...
-
bioRxiv - Microbiology 2021Quote: ... male and female Mongolian gerbils (35-49 g; Charles River) were infected via oral gavage with 5×108 CFU of bacteria on days 0 and 2 ...