Labshake search
Citations for Charles River Labs :
301 - 350 of 676 citations for G Protein Signaling Modulator 1 GPSM1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... For the immunogenic protein challenge experiments 9 week old female Balb/c mice were purchased from Charles River Laboratory.
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Developmental Biology 2019Quote: ... CD-1 (Charles River) was used to generate knockout mice ...
-
bioRxiv - Developmental Biology 2019Quote: ... CD-1 (Charles River) and Coq10a-/- mouse lines were maintained according to the University of California ...
-
bioRxiv - Cell Biology 2019Quote: CD-1 (Charles River) or C57BL/6 (JAX #000664) ...
-
bioRxiv - Developmental Biology 2019Quote: ... CD-1 (Charles River), Myh6-Cre (20) ...
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Pathology 2023Quote: CD-1 (CD-1; strain #022) outbred mice were purchased from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Molecular Biology 2024Quote: In vivo immunogenicity of gB protein in combination with adjuvants was evaluated in 6–8 week old BALB/c mice (Charles River) at Aragen Bioscience (Morgan Hill ...
-
bioRxiv - Microbiology 2020Quote: ... male mice were paired with 1 to 2 CD-1 female mice (Charles River) each night beginning at day 5 post infection ...
-
bioRxiv - Developmental Biology 2021Quote: CD-1 mice (Charles River) were used for wild-type expression and ex vivo organ culture studies ...
-
bioRxiv - Neuroscience 2019Quote: ... CD-1 mice (Charles River). Briefly ...
-
bioRxiv - Physiology 2021Quote: ... CD-1 (Charles River Labs), and NIH-Swiss (Envigo ...
-
bioRxiv - Neuroscience 2022Quote: CD-1 mice (Charles River) were used to produce WT mouse cortical neuron cultures as shown previously (Sathler et al. ...
-
bioRxiv - Biochemistry 2021Quote: CF-1 MEFs (Charles River) were transduced with inducible S TEMCCA and rtTA lentivirus-containing supernatants overnight in 8 μg/ml polybrene (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... CD-1 (Charles River Laboratories), or human transferrin receptor KI ...
-
bioRxiv - Neuroscience 2023Quote: ... and CD-1 (Charles River Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: ... CD-1 (Charles River Laboratories), or Sarm1-deficient mice (B6 ...
-
bioRxiv - Neuroscience 2023Quote: ... Adult CD-1 male mice and pregnant CD-1 dams were obtained from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Strain CRL:CD-1(ICR) ;CD-1) male and female breeder mice were obtained from Charles River Laboratories (Raleigh ...
-
bioRxiv - Immunology 2023Quote: ... 1-cell stage mouse embryos and then implanted into surrogate CD-1 mice (Charles River Laboratories). Pups born were screened for presence of the targeted allele and analyzed for proper expression ...
-
bioRxiv - Immunology 2019Quote: ... Female CD-1 mice (Charles River) were used as foster mothers ...
-
bioRxiv - Developmental Biology 2021Quote: CD-1 (Charles River stock #022) and C57BL/6J (Jackson Laboratory stock #000664 ...
-
bioRxiv - Neuroscience 2022Quote: Pregnant mice (CD-1, Charles River) were placed in a sterile environment following (dal Maschio et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... female CD-1 mice (Charles River), with an average weight of 30.2 g and age range of 6−10 weeks old ...
-
bioRxiv - Cell Biology 2022Quote: ... CF-1 MEFs (Charles River Laboratories) were transduced with inducible STEMCCA and rtTA lentivirus–containing supernatants overnight in polybrene (8 μg/ml ...
-
bioRxiv - Developmental Biology 2019Quote: CD-1 (Charles River, Tranent, UK) mice were maintained ...
-
bioRxiv - Developmental Biology 2022Quote: ... CD-1 mice from Charles River Laboratories were used for all experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... CD-1 (Charles River, Crl:CD1(ICR)) ...
-
bioRxiv - Neuroscience 2023Quote: CD-1 mice (Charles River Laboratories) were housed under a standard light/dark cycle with access to food and water ad libitum ...
-
bioRxiv - Systems Biology 2022Quote: CD-1 mice obtained from Charles River Germany were used for all experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... and electroporated mice CD-1 (Charles River) of both sexes at postnatal 4-8 weeks-old ...
-
bioRxiv - Neuroscience 2021Quote: CD-1 mice obtained from Charles River Germany were used for all experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... CF-1 (Charles River; Wilmington, MA, US) or C57BL/6J dams (Stock # 000664 ...
-
bioRxiv - Microbiology 2021Quote: ... Female outbred CD-1 (Charles River Laboratory), 20-24 grams ...
-
bioRxiv - Immunology 2022Quote: CD-1 female mice (Charles River Laboratories) 6-8 weeks of age were used for immunological studies ...
-
bioRxiv - Bioengineering 2022Quote: ... Male CD-1 mice (Charles River, Italy), weighing between 18-20 g ...
-
bioRxiv - Neuroscience 2021Quote: ... or wildtype CD-1 mice (Charles River), digested with papain (Worthington ...
-
bioRxiv - Immunology 2020Quote: ... and outbred CD-1 (Charles River Laboratories) mice of at least 6 weeks of age were randomly allocated into vaccination groups ...
-
bioRxiv - Immunology 2020Quote: CD-1 female mice (Charles River Laboratories) 7 weeks of age were used for immunological studies performed at the vivarium facilities of Omeros Inc ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... CD-1 (Charles River Laboratories, Wilmington, MA) and CF-1 (Envigo ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Female CD-1 mice (Charles River Laboratories) were crossed with male ERα-Cre mice to generate heterozygous ERα-Cre F1 male mice as aggressors ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: ... CD-1 outbred mouse strain (Charles River) was used to obtain wildtype embryos ...
-
bioRxiv - Immunology 2023Quote: ... or CD-1 mice (Charles River, UK) were randomly distributed into individually ventilated cages on arrival ...
-
bioRxiv - Microbiology 2023Quote: Outbred female CD-1 mice (Charles River), six- to eight-week-old ...
-
bioRxiv - Neuroscience 2024Quote: ... and five rats that were identified as significant outliers with a z-score ≥ 5 on at least one measure (n=1 F CORT Charles River, n= 2 F VEH Charles River, n=1 M VEH Taconic, n=1 M CORT Taconic). Statistical analyses were conducted on the remaining rats (Table 1).