Labshake search
Citations for Charles River Labs :
201 - 250 of 339 citations for Dengue Virus Serotype 3 Envelope Protein Mouse Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: Male C57BL/6 adult mice (n = 57; 3-5-month-old; 28-35 g) were used (Charles River). Before surgery ...
-
bioRxiv - Neuroscience 2023Quote: ... Experimental subjects were female Long Evans rats 3-to 8-months at the start of training (Charles River).
-
bioRxiv - Neuroscience 2024Quote: ... were placed in the home cage of adult male CD1 mice (3-10 months of age, Charles River), which had been prescreened for aggression prior to encountering the subject mice ...
-
bioRxiv - Neuroscience 2020Quote: ... Embryos (aged E12.5 - E16.5) of the mouse strain ICR (CD1, Charles River Laboratory) were used for in utero experiments and primary culture ...
-
bioRxiv - Neuroscience 2019Quote: Hippocampal neuronal cultures were prepared from C57BL/6J mouse embryos (Charles River Laboratories). UPF2-shRNA 1 virus is on a piLenti-shRNA-GFP backbone carrying one shRNA against the UPF2 mRNA (AGGCGTATTCTGCACTCTAAAGGCGAGCT) ...
-
bioRxiv - Neuroscience 2020Quote: ... Hippocampi were isolated from postnatal day 0 (P0) CD-1 mouse (Charles River) brain tissues and digested with 10U/mL papain (Worthington Biochemical Corp ...
-
bioRxiv - Neuroscience 2021Quote: ... DRG was dissected from embryonic days 13.5-14.5 CD1 mouse (Charles River Laboratories) and incubated with 0.05% Trypsin solution at 37 °C for 20 minutes ...
-
bioRxiv - Physiology 2024Quote: The following mouse strains were used in this study: C57BL/6 (Charles River), Sirt2flox 57 ...
-
bioRxiv - Biophysics 2022Quote: ... 100 µL of influenza solution (viral protein concentration from Charles River ∼ 0.2 mg/mL) was mixed in 400 µL of diluted Texas Red-DHPE suspension in HB buffer and incubated at room temperature in the dark for 2 h on a rocker ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3×106 exponentially growing Capan-1 cells were subcutaneously in Nude/balbc Mice (Charles River, 9 weeks old, females). After 1 week implantation ...
-
bioRxiv - Physiology 2022Quote: Neonatal rat cardiomyocytes (NRCM) were isolated from ∼3-day-old pups from Sprague- Dawley rats (Charles River, Stock 001) following standard protocols using the Worthington Neonatal Cardiomyocyte Isolation System (Worthington ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primary rat cardiomyocytes were isolated from 1-3 day old Sprague-Dawley rats (Charles River Laboratories, St-Constant, Quebec) as previously described with minor modifications (78) ...
-
bioRxiv - Physiology 2021Quote: Adult male Sprague-Dawley rats (aged 3 to 4 months; 300–325 □g; Charles River, Saint Constant, Quebec, Canada) were randomly assigned to either a fluid percussion TBI surgery or control treatment ...
-
bioRxiv - Physiology 2020Quote: CD® IGS (International Genetic Standard) rats (all males; age 3 mo upon arrival) were purchased from Charles River Laboratories International ...
-
bioRxiv - Neuroscience 2020Quote: Animals (all female and male C57BL6/J mice aged 3-7 months obtained from Jackson Laboratory or Charles River) were co-housed whenever possible ...
-
bioRxiv - Microbiology 2022Quote: ... 3-6 day old male and female Infant mice (CD1, catalog #: 022CD1) were purchased from Charles River (Wilmington, MA). Infant mice were transported with a female adult mouse ...
-
bioRxiv - Physiology 2024Quote: Neonatal rat cardiomyocytes (NRCM) were isolated from ∼3-day-old pups from Sprague-Dawley rats (Charles River, Stock 001) following standard protocols using the Worthington Neonatal Cardiomyocyte Isolation System (Worthington ...
-
bioRxiv - Bioengineering 2024Quote: A total of 4 adult male Sprague-Dawley rats (2-3 month old; 250-300 g) from Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2020Quote: ... All mouse lines were in the C57BL/6J background (>10 generations, Charles River, USA), besides Scn1a+/− mice that were in a mixed background (C57BL/6J-CD1 85:15%).
-
bioRxiv - Neuroscience 2021Quote: ... Biological specimens for imaging were obtained from a C57Bl6 mouse (Charles River Labs, UK) expressing mCherry sparsely in neurons of the Lateral Posterior nucleus (LP ...
-
bioRxiv - Neuroscience 2021Quote: ... The following mouse strains were used: wild type (C57BL/6N, Charles River Laboratories #027), Ai14 (JAX ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... and the resident was a white coat-coloured CD-1 mouse (Charles River, #022). For the rat resident-intruder protocol ...
-
bioRxiv - Genetics 2020Quote: ... We isolated mouse connective tissue from 8–10 week old CD1 mice (Charles River), intervertebral discs (IVDs ...
-
bioRxiv - Cell Biology 2022Quote: Mouse lines used for time-course experiments: C57BL/6 wild type (Charles River Laboratories), one 12 weeks old male and one 8 weeks female mice.
-
bioRxiv - Immunology 2022Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Plant Biology 2021Quote: Antibodies from guinea pig immunization with this purified protein product were obtained from Charles River biologics (USA).
-
bioRxiv - Microbiology 2021Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Neuroscience 2022Quote: Young adult (3-month-old) and aged (18-month-old) male C57BL/6 mice bred in-house from Charles River Laboratories were housed on sawdust bedding in a specific pathogen free facility (12 hours light/dark cycle) ...
-
bioRxiv - Neuroscience 2019Quote: ... 8 male Wistar Han IGS rats (250-400g; Charles Rivers) and 3 male Long Evans rats (350-400g; Charles River). We performed acute (anesthesia ...
-
bioRxiv - Molecular Biology 2024Quote: Mixed glial cell cultures were obtained from the brains of 1-3 days old newborn CD1 mice (Charles River, France). After removing meninges and large blood vessels ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Subjects were born in-house from 16 nulliparous timed-pregnant dams (Charles River; gestational age 3; 8-9 weeks old). Twelve to 24 hours after parturition (designated PND 1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... All other mouse experiments were performed on WT CD1 mice (Mus musculus, Charles River Laboratories).
-
bioRxiv - Neuroscience 2020Quote: ... WT mice used for backcrossing and mouse amplification are C57Bl6/J mice from Charles River Laboratories (L’Arbresle ...
-
bioRxiv - Cancer Biology 2022Quote: ... two-month old hairless albino mice (SKH1-Elite Mouse 477; Charles River Labs, Wilmington, MA) were divided into eight groups of 12 mice by sex ...
-
bioRxiv - Neuroscience 2021Quote: ... We used the following mouse lines in this study: Crl: CD1 (ICR) (Charles River: 022), Ai14 (Jackson Labs ...
-
bioRxiv - Neuroscience 2019Quote: ... unfixed tissue sections (12 µm) of mouse (P60-P70; Charles River, C57BL/6; n = 2), marmoset (n = 2) ...
-
bioRxiv - Developmental Biology 2021Quote: The following mouse strains were used: C57BL/6 (C57BL/6NCrl, Charles River Laboratories, strain 027) was the wild-type strain ...
-
bioRxiv - Microbiology 2020Quote: Mouse experiments were performed with Female Swiss OF1 mice (6-7 weeks old; Charles River. All animal experiments were granted a licence by the Competent Authority after an advice on the ethical evaluation by the Animal Experiments Committee Leiden (AVD1160020173304) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Wild-type mouse neonates were obtained from timed pregnant CD1 mice (Charles River Laboratories, #022). All animal studies were approved by the Administrative Panel on Laboratory Animal Care (APLAC ...
-
bioRxiv - Cell Biology 2023Quote: Hippocampal Primary neurons were isolated from E17-E19 C57BL/6 mouse brains (Charles River Laboratories) as described in Seibenhener et al (85) ...
-
bioRxiv - Microbiology 2024Quote: Mouse fecal samples were collected from nine female C3H/HeN mice purchased from Charles River Laboratories ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The C57BL/6J inbred strain (30 male and 30 female) was purchased at the age of 3 weeks from Charles River Laboratories ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... a CRISPR targeting the Fmr1 exon 8 sequence 5’-GGTCTAGCTATTGGTACTCATGG-3’ (PAM in bold) was injected into Crl:LE embryos (Charles River Laboratories). Two mutant strains were generated (LE-Fmr1em2Mcwi and LE-Fmr1em4Mcwi (RGDIDs ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... For our experiments 9-12 months old adult B6/j-Rj mice (n=23) and white BALB/c mice (n=3) were obtained from Charles River, Germany ...
-
bioRxiv - Bioengineering 2021Quote: ... (Protocol# IACUC-20-181) In-vivo stimulation with ME wireless power was confirmed in 3 different male Long-Evans rats (Charles River) ranging from 300g-400g ...
-
bioRxiv - Bioengineering 2020Quote: ... for DNA extraction originating from female C57BL/6J mice (3-4 months) and Wistar rats (6-9 months) were ordered from Charles River Laboratories ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: A group of thirteen female C57BL/6J CrL mice was purchased in December 2017 at the age of 3 weeks from Charles River, Sulzfeld ...
-
bioRxiv - Neuroscience 2021Quote: Rodent experiments were carried out on male or female adult (3–4-month-old) Sprague Dawley rats ordered from Charles River Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were transplanted into the #4 epithelium-free “cleared” fat pad of 3–4-week-old SCID/Beige mice (Charles River Laboratories ...