Labshake search
Citations for Charles River Labs :
1 - 50 of 146 citations for DHEA S ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... The plate-reader based LAL assay was performed with the Endosafe Endochrome-K kit (Charles River, #R1708K), where a control standard endotoxin (CSE ...
-
bioRxiv - Physiology 2021Quote: ... included 5-month (n = 5) and 22-month-old (n = 5) female C57Bl/6 mice from Charles River Laboratory ...
-
bioRxiv - Immunology 2020Quote: ... female outbred CD1 mice (N=5) aged 5-7 weeks (Charles River) were immunized with 20 μg of either wheat germ cell-free expressed UF1 ...
-
bioRxiv - Microbiology 2020Quote: ... 5 male C57BL/6 wild-type mice 5 to 6 weeks old (Charles River) per experimental group were used that were anesthetized by inhalation of isofluorane (Abbott ...
-
bioRxiv - Neuroscience 2024Quote: ... and aged (18-month-old) WT (n=10; (n=5 from Envigo and n=5 from Charles River) and KO (n=10 ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Biochemistry 2023Quote: Cortical neuron cultures were established from neonatal mouse brains (wild-type C57BL/6, Charles River, strain code 027, or the genotype(s) indicated for each experiment ...
-
bioRxiv - Neuroscience 2023Quote: Healthy adult Long-Evans rats (5 male, weight: 300-400g, age: 4-5 months; Charles River Laboratories, Calco, LC, Italy) were employed for this work ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: FVB mice (5 wk old) from Charles River Laboratories were used for all experiments ...
-
bioRxiv - Bioengineering 2020Quote: ... 5-6 week SCID/Bg mice (Charles River) or 175-200 gram Sprague Daley Rats (Charles River ...
-
bioRxiv - Neuroscience 2024Quote: Adenoviral vectors of serotype 5 (BioFocus, Charles River Laboratories Nederland B.V. ...
-
bioRxiv - Physiology 2019Quote: Experiments were performed using female C57BL/6J (n=5) (control) and DBA/2J (n=5) (glaucoma model) mice delivered by Charles River Lab ...
-
bioRxiv - Genomics 2021Quote: ... Pregnant mare serum gonadotropin (5 units) and human chorionic gonadotropin (5 units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories) with a 48-h interval ...
-
bioRxiv - Immunology 2021Quote: ... C57BL/6 mice 5-7 weeks old (Charles River) were used ...
-
bioRxiv - Immunology 2021Quote: ... C57BL/6 mice 5-7 weeks old (Charles River) were used ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 5-8 week old (Charles River; Raleigh, NC, USA), were maintained on a 12-hour light/dark cycle throughout the study and received ad libitum access to standard rodent chow (Harlan Laboratories ...
-
bioRxiv - Microbiology 2023Quote: 5-week-old male Swiss Webster mice (Charles River) were either infected ...
-
bioRxiv - Pathology 2022Quote: ... The pregnant mare serum gonadotropin (5 units) and the human chorionic gonadotropin (5 units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories, Kanagawa, Japan) with a 48h interval ...
-
bioRxiv - Neuroscience 2022Quote: ... we used 5 C57BL/6J mice (Charles River, all male). For behavior combined with optogenetics ...
-
bioRxiv - Immunology 2024Quote: Male C3H/HeNCrl (5 weeks old; Charles River, Raleigh, NC) mice were housed under barrier conditions with autoclaved food and bedding in sterilized cages equipped with sterile microfilter lids ...
-
bioRxiv - Immunology 2024Quote: 5-6 week-old mice were purchased from Charles River or Jackson Laboratory ...
-
bioRxiv - Cell Biology 2021Quote: Wild-type Sprague-Dawley rats (Male, 4-5 weeks, Charles River) were housed under a controlled environment with a 12-hour light-dark cycle and access to food and water ad libitum ...
-
bioRxiv - Neuroscience 2019Quote: ... 5 adult male Long-Evans rats (Charles River Laboratories, Wilmington, MA) were housed on a reverse light/dark cycle and food restricted on training days ...
-
bioRxiv - Immunology 2021Quote: ... 5 Female BALB/c mice 4-6 weeks old (Charles River) were used per group in our immunization studies ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5-week-old male Nu/MRI nude mice (from Charles River) were used ...
-
bioRxiv - Neuroscience 2022Quote: Male Sprague Dawley rats (n = 5, 16 h fasted; Charles River Laboratories Japan Inc. ...
-
bioRxiv - Cell Biology 2022Quote: 5-6 weeks old male NMRI Nude Mice (Charles River Laboratories) were injected into the heart with PC-3 Luc (11 mice ...
-
bioRxiv - Immunology 2023Quote: Animals were purchased from Charles River (housed in groups of 5) and were injected subcutaneously on the right flank with 0.5 million CT26 cells with tumor growth measured by calipers using the formula (L×W2)/2 ...
-
bioRxiv - Microbiology 2023Quote: 5-week-old male and female Swiss Webster mice (Charles River) were infected intraperitoneally with 500,000 T ...
-
bioRxiv - Cancer Biology 2023Quote: ... BALB/c nude mice (5-6-week-old, male, Charles River) were used for xenograft experiment.
-
bioRxiv - Neuroscience 2023Quote: C57BL/6 (6 weeks – 5 months) were acquired from Charles River and Jackson Laboratory ...
-
bioRxiv - Neuroscience 2023Quote: 3-5 months old male C57/BL6J mice (Charles River, UK) were anesthetized with isoflurane (4% induction ...
-
bioRxiv - Immunology 2024Quote: 5–8-week-old male and female IFNAR−/− mice (Charles River) were exposed intraperitoneally (IP ...
-
bioRxiv - Microbiology 2020Quote: Female C57BL/6 5 week-old mice were purchased from Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2022Quote: ... CD-1 (5-7 weeks old, Charles River Laboratories, Kingston, NY, USA), and CF-1 (5-7 weeks old ...
-
bioRxiv - Molecular Biology 2021Quote: ... Male Sprague–Dawley (SD) rats (5-6 weeks old, Charles River Laboratories) weighing between 150 and 200 grams were used in the chronic infusion studies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nude mice aged 5 to 6 weeks were purchased from Charles River Laboratories International ...
-
bioRxiv - Neuroscience 2022Quote: ... and C57BL/6J males (4- to 5-months of age, Charles River) for the application of DTT and DTDP ...
-
bioRxiv - Bioengineering 2023Quote: ... mice (BALB/c nude, female, 4-5 weeks old, Charles River, USA) were anesthetized by isoflurane and general area of the spleen was located ...
-
bioRxiv - Cancer Biology 2024Quote: ... were orthotopically injected in 5-week-old NSG mice (Charles River Laboratories). Once tumor xenografts were palpable (0.2×0.2 cm) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5-weeks old female BALB/c nude mice (Charles River, Arbresle, France) were randomized ...
-
bioRxiv - Immunology 2021Quote: Syrian golden hamsters (males, 5-6 weeks old) were purchased from Charles River Laboratories (Saint-Constant ...
-
bioRxiv - Neuroscience 2020Quote: ... Juvenile C57/BL6J mice (5-7 weeks old, Charles River, Sulzfeld, Germany, male) were bilaterally injected with AAV2/1 ...
-
bioRxiv - Microbiology 2021Quote: Three litters of 4–5-day old C57BL/6 infant mice (Charles River) were separated from their dams upon receipt and placed into isolation incubators with padding and nesting material ...
-
bioRxiv - Immunology 2020Quote: Female C57BL/6 mice (5-8 weeks old) were purchased from Charles River Laboratories ...
-
bioRxiv - Bioengineering 2019Quote: ... C57BL/6 male mice (8 weeks old, Charles River, n = 5 mice/condition) were anaesthetised using isoflurane gas ...
-
bioRxiv - Neuroscience 2022Quote: ... and CF-1 (5-7 weeks old, Charles River Lab, Kingston, NY, USA). Animals were allowed free access to food and water ...
-
bioRxiv - Neuroscience 2021Quote: ... The experiments were performed using 3-5-week-old Wistar rats (Charles River), 6-10-week-old male C57BL/6N wild type (Charles River ...
-
bioRxiv - Cancer Biology 2020Quote: Heterozygous nude mice (Crl:NU(NCr)-Foxn1nu/+) between 5 - 6 weeks old (Charles River) were housed in sterile cages at the Health Sciences Research Building Animal Facility at Emory University ...
-
bioRxiv - Biochemistry 2020Quote: Female nu/nu mice aged 4–5 weeks were obtained from Charles River. Luciferase expresing-OVCAR-8 cells were harvested by trypsinization ...