Labshake search
Citations for Charles River Labs :
351 - 359 of 359 citations for Borrelia burgdorferi C t Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Cancer Biology 2020Quote: ... 1 × 106 EMT6 cells (ATCC®, CRL2755™) were injected into the fourth mammary fad pad of female Balb/c mice (Charles River Labs). Tumors were allowed to grow up to 50-100 mm3 in size ...
-
bioRxiv - Cancer Biology 2023Quote: A suspension of 100 µL PBS containing a total of 3 × 106 NCI-H460 Fluc cancer cells was injected subcutaneously into female Balb/c nu/nu mice aged 6 to 9 weeks (Charles River Laboratories, n = 20). Tumor dimensions were measured using calipers and the volume calculated using the following equation ...
-
bioRxiv - Cell Biology 2024Quote: ... hippocampal pruning analysis was performed on TTLL1 constitutive knock-out 14 (named here TTLL1KO; gift from Dr. C. Janke, Institut Curie, Orsay, France) backcrossed to CD-1 (Charles River, Strain Code 022) for three generations ...
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...