Labshake search
Citations for Charles River Labs :
351 - 373 of 373 citations for Adenovirus Type 40 Hexon Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... and consisted of three sessions in a ~30 x 35 x 40 cm Plexiglass behavioral chamber (J. Green, Charles River Maker Lab) interleaved with four 15-20 minute sleep sessions in a ~30 x 30 x 40 cm black box (rest box) ...
-
bioRxiv - Cell Biology 2019Quote: ... BMDCs and bone marrow-derived macrophages (BMDMs) were harvested from wild-type 7-9-week-old female C57BL/6J mice or C3H/HeN mice (Charles River Canada, Montreal, QC) as previously described with minor modifications [107 ...
-
bioRxiv - Neuroscience 2019Quote: ... All behavioral tests using Auts2del8 mice were obtained by crossing Auts2del8/+ heterozygous male mice with wild type C57BL6/N female mice (Charles River Laboratories, Kanagawa, Japan) to avoid the possibility that altered behaviors in the mutant dams could influence the postnatal development of their offspring ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... AhR knock out mice (Ahr−/−) on C57BL/6 background and their C57BL/6 congenic littermates wild type (Ahr+/+) were originally supplied by Charles River (Wilmington, MA, USA). Colonies were housed under controlled temperature (22 °C ...
-
bioRxiv - Immunology 2019Quote: Animals used in the present study were 6-8 weeks old male or female wild-type C57BL/6 (Charles River Laboratories, Charleston, SC, USA), PLD1-/- or PLD2-/- mice (weighing 20-25 g) ...
-
bioRxiv - Microbiology 2023Quote: ... Rag2+/− and TCRβ+/− mice were derived in our animal facility by breeding the knockout strains to C57BL/6 wild-type mice (Charles River strain number 556). Unless otherwise specified ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2020) were generated as previously described and compared to age and sex matched wild-type C57Bl/6 controls (Charles River, UK or Vital-River, China). Endothelial-specific cyclo-oxygenase-1 knockout mice (Ptgs1flox/flox ...
-
bioRxiv - Neuroscience 2020Quote: ... Brain tissue sections (40-μm thick) from a total of 16 Long Evans rats (14 males, 2 females; Charles River; 250-350g on arrival) were used in these experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... They had unlimited chow (Rodent 5075, 18% protein, 4.5% fat, Charles River Laboratories) until 2 days before the commencement of food self-administration training ...
-
bioRxiv - Biophysics 2022Quote: ... 100 µL of influenza solution (viral protein concentration from Charles River ∼ 0.2 mg/mL) was mixed in 400 µL of diluted Texas Red-DHPE suspension in HB buffer and incubated at room temperature in the dark for 2 h on a rocker ...
-
bioRxiv - Immunology 2022Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Plant Biology 2021Quote: Antibodies from guinea pig immunization with this purified protein product were obtained from Charles River biologics (USA).
-
bioRxiv - Microbiology 2021Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant proteins were tested for LPS content by the chromogenic Limulus amebocyte lysate assay (Endochrome; Charles River), and the endotoxin content was less than 0.01 U per microgram of recombinant proteins.
-
bioRxiv - Bioengineering 2023Quote: ... For the immunogenic protein challenge experiments 9 week old female Balb/c mice were purchased from Charles River Laboratory.
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Molecular Biology 2024Quote: In vivo immunogenicity of gB protein in combination with adjuvants was evaluated in 6–8 week old BALB/c mice (Charles River) at Aragen Bioscience (Morgan Hill ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...