Labshake search
Citations for Charles River Labs :
301 - 350 of 422 citations for Mouse Anti Staphylococcus Aureus Enterotoxin G Antibody SEG 59 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... We used the adult male Sprague-Dawley rats (age: 8-10 weeks; weight: 270-320 g; provided by Orient Bio, Rep. of Korea, colony reference at Charles River Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: Forty-four 56 day-old rats (body weight: 150-250 g; males: n=22, females: n=22) were purchased from Charles River for the study ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: The experiments were conducted on three Sprague-Dawley rats (175-200 g upon arrival; Charles River, Italy; 6 weeks of age). When not undergoing testing protocols ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... five female) weighing 200-300 g and aged 10-12 weeks at the start of the experiment were purchased from Charles River. Rats were housed singly and maintained on a 12-hour standard light/dark cycle ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: A total of 58 young adult male Wistar rats (300-325 g at the beginning of experiments, Charles River, Lyon, France) were used ...
-
bioRxiv - Systems Biology 2024Quote: All rats were wild-type Sprague Dawley rats (Rattus norvegicus) obtained from Charles River (8-10 weeks old, 300-350 g) and bred and maintained at the animal center of Yale University ...
-
bioRxiv - Neuroscience 2024Quote: ... Male BALB/cJ and CD-1 mice (9-10 weeks old) weighing 30-50 g at the beginning of the experiments were purchased from Charles River Laboratories (Raleigh ...
-
bioRxiv - Neuroscience 2023Quote: ... 8- to 12-week old adult female CF-1 mice (weighing from 30 to 35 g) were purchased from Charles River Laboratories and housed in the University Animal Facility ...
-
bioRxiv - Neuroscience 2020Quote: Somatic NSCs were obtained from the subventricular zone (SVZ) of 7-12-week-old (18-20 g) C57BL/6 mice (Charles River, UK). Briefly ...
-
bioRxiv - Bioengineering 2022Quote: ... We performed the in vivo experiments on male Wistar rats with a jugular vein catheter weighing approximately 300 g (Charles River, MA). The experiments followed the Johns Hopkins University Animal Care and Use Committee protocol number RA19M207 ...
-
bioRxiv - Neuroscience 2023Quote: Adult male Long-Evans rats were used in this study (n = 15, 300–500 g, 3 – 5 months old, Charles River Laboratories). All animal procedures were performed according to the protocol approved by the Institutional Animal Care and Use Committee at Cedars-Sinai Medical Center ...
-
bioRxiv - Neuroscience 2023Quote: ... Experiments were conducted on Sprague Dawley (nerve stimulation) or Lewis (chronic nerve electrophysiology recordings) female rats ∼150-200 g in weight (Charles River, UK). Rats were group-housed in individually ventilated cages with ad libitum access to food and water for the duration of the study.
-
bioRxiv - Synthetic Biology 2022Quote: ... Experiments were performed on outbred strain CD1 mouse pups (Charles River Laboratories). Analyses are thought to include animals of both sexes at approximately equal proportions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mouse experiments: 6-8 weeks-old female BalB/c mice (Charles River) were used in all experiments ...
-
bioRxiv - Neuroscience 2021Quote: The C57BL/6J mouse line was used as background strain (Charles River). Mice expressing Cre from the Pitx3 locus and Cre induced YFP from the Rosa26 were previously described (35 ...
-
bioRxiv - Neuroscience 2022Quote: Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17 ...
-
bioRxiv - Neuroscience 2022Quote: Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17 ...
-
bioRxiv - Immunology 2023Quote: ... B6.SJL-PtprcaPepcb/BoyCrl (CD45.1) mouse stain was obtained from Charles River Laboratory ...
-
bioRxiv - Neuroscience 2023Quote: Primary DRGs were cultured from E13.5 CD1 mouse embryos (Charles River Laboratories). DRGs were dissected in DMEM ...
-
bioRxiv - Cell Biology 2024Quote: The mouse strains used in this study were purchased from Charles River Laboratories (ICR mice ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: Male and female Wistar rats (n=10, weighing 200-250 g at the time of arrival, and obtained from Charles River (Sulzfeld, Germany)) were used for breeding ...
-
bioRxiv - Neuroscience 2023Quote: ... Experiments were performed in adult female C57B6L/6 mice (2 to 3 months of age, 20 to 25.1 g) (Charles River, Strain code:027). All procedures were performed under general anesthesia (20 mg/kg ketamine ...
-
bioRxiv - Physiology 2023Quote: Fifteen sexually mature female CD-1 mice (sacrificial age ∼ 34 weeks; mass = 44.1 ± 7.9 g) were obtained (Charles River Laboratories, Senneville, QC, Canada) with approval from the University of Guelph’s Animal Care Committee and all protocols followed CCAC guidelines ...
-
bioRxiv - Neuroscience 2024Quote: Female Sprague-Dawley rats (∼200 g and 9 weeks on arrival, witnesses/controls) and male Sprague-Dawley rats (∼250 g on arrival, intruders) were obtained from Charles River (Durham, NC) while male Long-Evans retired breeders (600-800 g ...
-
bioRxiv - Pathology 2024Quote: ... aged 12–14 weeks) (Harlan, Venray, The Netherlands) or spontaneously hypertensive male Wistar-Kyoto (280–320 g, aged 12–14 weeks) (Charles River, Sulzfeld, Germany) were randomly allocated to their respective control group after an acclimatization period ...
-
bioRxiv - Immunology 2024Quote: ... Female BALB/c mice of 11-16 weeks with body weight between 19 and 24 g were used for the experiments (Charles River, Sulzfeld, Germany). The local animal facility environment had a temperature of 22°C and a humidity of 45-60% followed a 12-hour light/dark cycle ...
-
bioRxiv - Neuroscience 2020Quote: ... Embryos (aged E12.5 - E16.5) of the mouse strain ICR (CD1, Charles River Laboratory) were used for in utero experiments and primary culture ...
-
bioRxiv - Neuroscience 2019Quote: Hippocampal neuronal cultures were prepared from C57BL/6J mouse embryos (Charles River Laboratories). UPF2-shRNA 1 virus is on a piLenti-shRNA-GFP backbone carrying one shRNA against the UPF2 mRNA (AGGCGTATTCTGCACTCTAAAGGCGAGCT) ...
-
bioRxiv - Neuroscience 2020Quote: ... Hippocampi were isolated from postnatal day 0 (P0) CD-1 mouse (Charles River) brain tissues and digested with 10U/mL papain (Worthington Biochemical Corp ...
-
bioRxiv - Neuroscience 2021Quote: ... DRG was dissected from embryonic days 13.5-14.5 CD1 mouse (Charles River Laboratories) and incubated with 0.05% Trypsin solution at 37 °C for 20 minutes ...
-
bioRxiv - Physiology 2024Quote: The following mouse strains were used in this study: C57BL/6 (Charles River), Sirt2flox 57 ...
-
bioRxiv - Neuroscience 2022Quote: Experiments were carried out with male Lister Hooded rats (3 months old, 250-300 g at the beginning of the experiments) provided by an authorized supplier (Charles River Laboratories, Barcelona, Spain). Upon their arrival at Pablo de Olavide Animal House (Seville ...
-
bioRxiv - Physiology 2020Quote: White fat adipocytes were isolated from the epididymal fat pads of male CD-1 mice (fed ad libitum, 12 hr. dark/light cycle, weight 25 – 35 g; Charles River Laboratory, Kent, UK). Adipocytes were isolated by collagenase digestion as previously described (Bentley et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... male Spontaneously Hypertensive Rats (SHR) (n=15) and Wistar Kyoto rats (WKY) (n=13) (50–60 g on arrival, Charles River Laboratories, Wilmington MA) were used in the present study ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary mouse myoblasts (mskMPs) from 3-week-old C57Bl6/J (Charles River, C57BL/6NCrl) mice were maintained in collagen I coated dishes (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... All mouse lines were in the C57BL/6J background (>10 generations, Charles River, USA), besides Scn1a+/− mice that were in a mixed background (C57BL/6J-CD1 85:15%).
-
bioRxiv - Neuroscience 2021Quote: ... Biological specimens for imaging were obtained from a C57Bl6 mouse (Charles River Labs, UK) expressing mCherry sparsely in neurons of the Lateral Posterior nucleus (LP ...
-
bioRxiv - Neuroscience 2021Quote: ... The following mouse strains were used: wild type (C57BL/6N, Charles River Laboratories #027), Ai14 (JAX ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... and the resident was a white coat-coloured CD-1 mouse (Charles River, #022). For the rat resident-intruder protocol ...
-
bioRxiv - Genetics 2020Quote: ... We isolated mouse connective tissue from 8–10 week old CD1 mice (Charles River), intervertebral discs (IVDs ...
-
bioRxiv - Cell Biology 2022Quote: Mouse lines used for time-course experiments: C57BL/6 wild type (Charles River Laboratories), one 12 weeks old male and one 8 weeks female mice.
-
bioRxiv - Physiology 2022Quote: ... Adult male Sprague-Dawley rats (200-225 g) or adult male C57BL/6J mice (63-70 days; purchased from Charles river UK Ltd, Kent, UK) were killed by cervical dislocation and kidney tissue slices were obtained as previously described (11).
-
bioRxiv - Developmental Biology 2021Quote: ... All other mouse experiments were performed on WT CD1 mice (Mus musculus, Charles River Laboratories).
-
bioRxiv - Neuroscience 2020Quote: ... WT mice used for backcrossing and mouse amplification are C57Bl6/J mice from Charles River Laboratories (L’Arbresle ...
-
bioRxiv - Cancer Biology 2022Quote: ... two-month old hairless albino mice (SKH1-Elite Mouse 477; Charles River Labs, Wilmington, MA) were divided into eight groups of 12 mice by sex ...
-
bioRxiv - Neuroscience 2021Quote: ... We used the following mouse lines in this study: Crl: CD1 (ICR) (Charles River: 022), Ai14 (Jackson Labs ...
-
bioRxiv - Neuroscience 2019Quote: ... unfixed tissue sections (12 µm) of mouse (P60-P70; Charles River, C57BL/6; n = 2), marmoset (n = 2) ...
-
bioRxiv - Developmental Biology 2021Quote: The following mouse strains were used: C57BL/6 (C57BL/6NCrl, Charles River Laboratories, strain 027) was the wild-type strain ...
-
bioRxiv - Microbiology 2020Quote: Mouse experiments were performed with Female Swiss OF1 mice (6-7 weeks old; Charles River. All animal experiments were granted a licence by the Competent Authority after an advice on the ethical evaluation by the Animal Experiments Committee Leiden (AVD1160020173304) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Wild-type mouse neonates were obtained from timed pregnant CD1 mice (Charles River Laboratories, #022). All animal studies were approved by the Administrative Panel on Laboratory Animal Care (APLAC ...