Labshake search
Citations for Charles River Labs :
251 - 296 of 296 citations for Human Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: Murine OT-I CD8+ T cells or 1G4 CD8+ T cells were isolated from the spleen and lymph nodes of OT-I mice (C57BL/6-Tg(TcraTcrb)1100Mjb/Crl (Charles River)) or A2Eso1G4 HHD mice ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 × 106 BM1-VC or BM1-RKIP cells were injected orthotopically into the mammary fat pad of athymic nude mice (Charles River). When tumors reached 20-30 mm3 in volume ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 × 104 4T1-VC or 4T1-KMT5C cells were injected orthotopically into the mammary fat pad of BALB/c mice (Charles River). The mice were euthanized four weeks after tumor cell implantation ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 × 106 BM1-VC or BM1-KMT5C cells were injected orthotopically into the mammary fat pad of athymic nude mice (Charles River). The mice were euthanized four weeks post tumor cell implantation ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 × 105 BM1-luc cells with or without KMT5C overexpression were injected into the left ventricle of the heart of athymic nude mice (Charles River) for systemic distribution of tumor cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus was transduced into freshly isolated Lin- bone marrow cells derived from 3 month old B6.SJL mice (from Charles River) after Lin+ cell depletion using mouse Lineage Cell Depletion Kit (Miltenty Biotec) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were transplanted into the #4 epithelium-free “cleared” fat pad of 3–4-week-old SCID/Beige mice (Charles River Laboratories ...
-
bioRxiv - Cell Biology 2024Quote: Xenografts were generated by injecting 8×106 cells (HCT116) subcutaneously into flanks of female Athymic Nude (Crl:NU(NCr)-Foxn1nu) mice (Charles River Laboratories). Each animal was injected with cells depleted for CRY1 (right flank ...
-
bioRxiv - Cancer Biology 2021Quote: ... approximately 5×106 viable cells in 100 μl PBS were injected subcutaneously into the right flanks of 6-week-old NOD-SCID mice (Charles River Laboratories).
-
bioRxiv - Biophysics 2019Quote: Cortical and hippocampal cells were obtained from embryos of 18 days of gestation of C57 BL/6J mice (Charles River, Wilmington, USA). The experiments in this study were approved by the local ethic committee ...
-
bioRxiv - Neuroscience 2021Quote: Cultured glial cells were obtained from cortex and cultured DA neurons were obtained from the midbrain of P1-P3 Wistar rats (Charles River, Germany). Gender was mixed as the cultures were generated from a mixed sex populations of rat pups ...
-
bioRxiv - Cancer Biology 2020Quote: ... and iv experiments were experiments using subcutaneous cell-xenograft models generated by injecting cells into the flanks of 6-week-old female athymic NCr-nu/nu mice (Charles River Laboratories). The iii and v experiments were performed using patient-derived xenografts (PDXs) ...
-
bioRxiv - Cancer Biology 2020Quote: Tumor formation was assessed by sub-cutaneous injection of cells into CD-1 nude mice (Crl: CD-1-Foxn1nu, Charles River Laboratories). Murine mp53/Ras cells were grown at 39°C for 2 days prior to injection and implanted via sub-cutaneous injection of 5×105 mp53/Ras in RPMI 1640 with no additives ...
-
bioRxiv - Cancer Biology 2020Quote: ... 14×106 cells (in 50 μl) were injected into the anterior prostate of CD1-nude mice (Charles River Laboratories, Wilmington, MA, USA). For CRPC conditions ...
-
bioRxiv - Cancer Biology 2022Quote: Single-cell suspensions of 8×105 #253 (EGFP+ or EGFP-) cells were injected into the tail vein of 6-week-old nude CD1 male mice (Charles River Laboratories) (n=5 per group) ...
-
bioRxiv - Microbiology 2021Quote: ... and those that reached 2-cell stage of development were implanted into the oviducts of pseudopregnant foster mothers (CD-1 mice from Charles River Laboratory). Offspring born to the foster mothers were genotyped by PCR and sanger sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... were differentiated from bone marrow cells collected from the femurs and tibiae of six to eight-week-old male C57BL/6 (Charles River Laboratories). For macrophage differentiation ...
-
bioRxiv - Genetics 2022Quote: ... and those embryos which reached 2-cell stage of development were implanted into the oviducts of pseudo-pregnant foster mothers (CD-1 mice from Charles River Laboratory). Offspring born to the foster mothers were genotyped by PCR ...
-
bioRxiv - Microbiology 2020Quote: BMDM and BMDC were generated from bone marrow precursor cells extracted from femurs and tibiae of 6-8 week-old male or female C57BL/6 mice (Charles River Laboratories).
-
bioRxiv - Cancer Biology 2021Quote: ... or NCIN87 shRNA 479 cancer cells were subcutaneously implanted in female athymic nude mice nu/nu (8 to 10 weeks old, Charles River Laboratories). A total of 5 million cells were suspended in 150 μL of a 1:1 v/v mixture of medium with reconstituted basement membrane (BD Matrigel ...
-
bioRxiv - Immunology 2022Quote: ... those embryos at the 2-cell stage were implanted into the oviducts of pseudo-pregnant surrogate mothers (CD1 strain from Charles River Laboratory). Offspring were genotyped by PCR (Table 5) ...
-
bioRxiv - Genomics 2023Quote: ... Resuspended cells were kept on ice and inoculated into the pons of 4–6 week-old female Nod scid mice (Charles River Laboratory) by stereotactic injections at 1.5 mm to the right of midline ...
-
bioRxiv - Bioengineering 2022Quote: Cortical neurons and glial cells were harvested from the cortical hemispheres dissected from C57BL/6 mouse embryo brains at E15-16 (Charles River Laboratories). Pregnant mice were euthanized by cervical dislocation ...
-
bioRxiv - Microbiology 2023Quote: ... Fertilized oocytes were scored and separated the next morning at the two-cell stage for surgical transfer to pseudopregnant CD-1 recipient females (Charles River, #022). Heterozygote mice were transferred to the University of Kansas Animal Care Unit and heterozygote pairs were bred to create PARP12+/+ ...
-
bioRxiv - Cancer Biology 2022Quote: Orthotopic syngeneic allografts were generated by intraperitoneal injection of one million of the murine cells KPC luc2 into 6-week-old female C57BL/6 mice (immunocompetent strain, SOPF health status, Charles River, France). Tumoral growth was followed by bioluminescence upon injection of 3 mg luciferin-EF (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... bone marrow (BM) cells were isolated from 4-week old female wild-type (WT) C57BL/6J (Charles River laboratories, North Wilmington, Mass) and STING-KO mice (C57BL/6J-Tmem173gt/J ...
-
bioRxiv - Cancer Biology 2023Quote: 3 × 106 H460 cancer cells in 100 µL PBS were injected subcutaneously into female Balb/C nu/nu mice aged 6-9 weeks (Charles River Laboratories). Tumour growth was monitored using an electronic caliper and the volume calculated using the following equation ...
-
bioRxiv - Genomics 2024Quote: ... Non-small cell lung cancer (NSCLC) PDX models were implanted subcutaneously in 4– 6-week-old female NMRI nude mice (Charles River, Germany) under isoflurane anesthesia ...
-
bioRxiv - Immunology 2021Quote: ... the cells were washed and cultured in 48-well plates for 2 weeks supplemented with recombinant interleukin-2 (IL-2, Charles River Labs, USA) at 20 IU / mL every 2–3 days thereafter ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50 µl of cell suspension were injected orthotopically into the anterior prostate lobe of 10-weeks old CD1-nude male mice (Charles River Laboratories, UK). Orchidectomy was either performed at the time of injection (22rv1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5×104 viable cells were slowly injected into the right hemisphere of 8-10 week old male nude mice (RRID:MGI:5653040; Charles River, Wilmington, Massachusetts, USA) using a 10 µl micro-syringe (#80308 ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 × 106 viable A375 cells in 100 μl PBS were injected into the 6–8-week-old female athymic mice (BALB/c; Charles River, Beijing, China). One week after inoculation ...
-
bioRxiv - Molecular Biology 2021Quote: ... MKN45-hnRNP-MKO or double KO cells were injected into the flank of 8-10-week-old NOD-SCID (NOD.CB17-Prkdcscid/J, Charles River, Strain code: 634). Groups of 11 mice were used per cell type ...
-
bioRxiv - Immunology 2022Quote: ... Brca1-/-cells in PBS were injected via intraperitoneal route in 8–10-week-old female C57BL/6 mice (Charles River Laboratories International Inc.). All mice were maintained under specific pathogen-free conditions ...
-
bioRxiv - Bioengineering 2022Quote: ... Five million cells were injected into the right flank of six- to eight-week-old Balb/c mice (Charles River Laboratories, Wilmington, USA). Mice were housed in the Laboratory Animal Facility of the Stanford University Medical Center (Stanford ...
-
bioRxiv - Bioengineering 2022Quote: ... Five million cells were injected into the right flank of six- to eight-week-old Nu/Nu mice (Charles River Laboratories, Wilmington, USA) after being mixed with Matrigel (Corning ...
-
bioRxiv - Bioengineering 2023Quote: Glial cells were isolated from the cerebral cortex of postnatal day 1-2 Sprague-Dawley rat brains (Charles River, OrientBio Inc., South Korea) following previously described methods (22,23) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 × 106 EMT6 cells (ATCC®, CRL2755™) were injected into the fourth mammary fad pad of female Balb/c mice (Charles River Labs). Tumors were allowed to grow up to 50-100 mm3 in size ...
-
bioRxiv - Cancer Biology 2021Quote: ... before being subcutaneously injected in one flank of 12 (n=6 mice per cell line) 6-week-old female immunodeficient NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ (NSG) mice (Charles River UK Ltd (Margate, Kent)) ...
-
bioRxiv - Cancer Biology 2021Quote: 10 million TOV21G cells infected with GFP lentivirus were injected intraperitoneally into athymic nude female mice at 6 weeks of age (Charles River Laboratories, Crl:NU(NCr)-Foxn1nu) ...
-
bioRxiv - Cancer Biology 2022Quote: ... MCF7-BM02-1 or MCF7-BM02-TAM67 were made to transplant the cells into 6-week-old female NOD.CB-17-Prkdc
/J mice (NOD/scid, Charles River Japan, Inc., Kanagawa, Japan)56,58 ... -
bioRxiv - Immunology 2022Quote: ... Brca1-/-luciferase-tagged cells in PBS were injected via intraperitoneal route in 8–10-week-old female C57BL/6 mice (Charles River Laboratories International Inc.). Imaging was started at day-7 post-cell injection ...
-
bioRxiv - Cancer Biology 2023Quote: A suspension of 100 µL PBS containing a total of 3 × 106 NCI-H460 Fluc cancer cells was injected subcutaneously into female Balb/c nu/nu mice aged 6 to 9 weeks (Charles River Laboratories, n = 20). Tumor dimensions were measured using calipers and the volume calculated using the following equation ...
-
bioRxiv - Biophysics 2020Quote: ... tumour was generated by injecting 1 × 106 MDA-MB-231 cells into the lower right MFP of 4 female NOD scid gamma (NSG) mice (6-7 weeks old; Charles River Laboratories, Wilmington, MA, USA). Cells were suspended in 0.05 mL of HBSS per injection ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 5 μL of the cell suspension were injected stereotactically into the striatum of 6–8-week-old female severe combined immunodeficient (SCID) mice (Charles River Frederick Research Model Facility) using a stereotactic device ...
-
bioRxiv - Genetics 2023Quote: ... XYΔ mutant rats [SD-Del(Yp)1Mcwi (RGD:155663364)] were generated at MCW by pronuclear injection of these two CRISPR-Cas9 ribonucleoproteins targeting the sequences GCATGTGGGCAGTTTCCACCTGG and ACACAGCTCCTCTCTGGTAGAGG (protospacer adjacent motif underlined) into single-cell Crl:SD (Charles River Laboratories, Crl:SD strain code 400) embryos ...