Labshake search
Citations for Charles River Labs :
201 - 237 of 237 citations for Dengue Virus Serotype 3 Envelope Protein Human Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... a CRISPR targeting the Fmr1 exon 8 sequence 5’-GGTCTAGCTATTGGTACTCATGG-3’ (PAM in bold) was injected into Crl:LE embryos (Charles River Laboratories). Two mutant strains were generated (LE-Fmr1em2Mcwi and LE-Fmr1em4Mcwi (RGDIDs ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... For our experiments 9-12 months old adult B6/j-Rj mice (n=23) and white BALB/c mice (n=3) were obtained from Charles River, Germany ...
-
bioRxiv - Bioengineering 2021Quote: ... (Protocol# IACUC-20-181) In-vivo stimulation with ME wireless power was confirmed in 3 different male Long-Evans rats (Charles River) ranging from 300g-400g ...
-
bioRxiv - Bioengineering 2020Quote: ... for DNA extraction originating from female C57BL/6J mice (3-4 months) and Wistar rats (6-9 months) were ordered from Charles River Laboratories ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: A group of thirteen female C57BL/6J CrL mice was purchased in December 2017 at the age of 3 weeks from Charles River, Sulzfeld ...
-
bioRxiv - Neuroscience 2021Quote: Rodent experiments were carried out on male or female adult (3–4-month-old) Sprague Dawley rats ordered from Charles River Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were transplanted into the #4 epithelium-free “cleared” fat pad of 3–4-week-old SCID/Beige mice (Charles River Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: Nine male (N = 5) and female (N = 4) Long Evans rats (Th-cre-littermates, N = 6; Charles River Laboratories, N = 3) aged 9-11 weeks at the time of surgery were used to record dopamine release in the BLA across Pavlovian long-delay conditioning ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Animals were obtained at either 3-4 weeks old/50-75g (behavioral experiments) and 5-6 weeks old/100-125g (Western blotting experiments) from Charles River Laboratories and housed in a 12h:12h reverse light/dark cycle facility ...
-
bioRxiv - Pathology 2022Quote: ... The pregnant mare serum gonadotropin (5 units) and the human chorionic gonadotropin (5 units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories, Kanagawa, Japan) with a 48h interval ...
-
bioRxiv - Developmental Biology 2021Quote: Pregnant mare serum gonadotropin (five units) and human chorionic gonadotropin (five units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories, Kanagawa, Japan) at a 48-h interval ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant proteins were tested for LPS content by the chromogenic Limulus amebocyte lysate assay (Endochrome; Charles River), and the endotoxin content was less than 0.01 U per microgram of recombinant proteins.
-
bioRxiv - Biochemistry 2020Quote: ... Primary rat neonatal cardiac fibroblasts were isolated from 1-3 day old Sprague-Dawley rat pups (Charles River Laboratories, St-Constant, Quebec) as previously described (Calderone et al. ...
-
bioRxiv - Neuroscience 2022Quote: Experiments were performed on 32 male Long-Evans rats (n=16 for each group, >3 months of age at the start of the experiment, Charles River Laboratories) housed on a 12 hr light/dark cycle at 25 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... and female (n = 16) and 3-week-old C57BL6/J male (n = 12) and female (n = 12) mice supplied by Charles River (Japan) were maintained in the experimental animal facility of Juntendo University Graduate School of Medicine under a 12:12-hour light ...
-
bioRxiv - Microbiology 2022Quote: ... we used the transgenic GFP P.berghei parasites (ANKA 2.34 strain) kept by serial passages into 3-4 weeks old female BALB/c mice (Charles River, Wilmington, MA) starting from frozen stocks ...
-
bioRxiv - Microbiology 2019Quote: ... Approximately 106 colony forming units (CFUs) in 50 µl were introduced orogastrically to 3- to 5-day-old CD-1 mice (Charles River Laboratories). Infected animals were subsequently gavaged with 50µL 10mM ethanolamine (EA ...
-
bioRxiv - Neuroscience 2022Quote: ... Brain slice electrophysiology and MEA experiments were performed on male or female CF-1 ™ mice (3-5 weeks old, Charles River). All the mice colonies were maintained in the Animal Resource Facility at Xenon Pharmaceuticals ...
-
bioRxiv - Neuroscience 2023Quote: Adult male Long-Evans rats were used in this study (n = 15, 300–500 g, 3 – 5 months old, Charles River Laboratories). All animal procedures were performed according to the protocol approved by the Institutional Animal Care and Use Committee at Cedars-Sinai Medical Center ...
-
bioRxiv - Neuroscience 2023Quote: Experiments were performed on a total of 31 male Long-Evans rats (>3 months of age at the start of the experiment, Charles River Laboratories) housed on a 12 hr light/dark cycle at 25 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... CB5083 (15-25 mg/kg/day) was given to male BALB/c mice (8-10 weeks of age, n = 3 animals/group, Charles River Laboratories) by oral gavage (OG ...
-
bioRxiv - Microbiology 2024Quote: Subcutaneous murine infection was conducted as previously described (8–11) with the following modifications: For 3-day infections seven-week-old female SKH1 hairless mice (Charles River Labs) were injected subcutaneously with 107 CFU into both the left and right rear thighs ...
-
bioRxiv - Bioengineering 2023Quote: ... For the immunogenic protein challenge experiments 9 week old female Balb/c mice were purchased from Charles River Laboratory.
-
bioRxiv - Neuroscience 2021Quote: A total of 16 female and 12 male Wistar rats (250–300g upon arrival at an age of ca. 3 months) were obtained from Charles River (Sulzfeld, Germany). Before testing ...
-
bioRxiv - Neuroscience 2023Quote: ... Experiments were performed in adult female C57B6L/6 mice (2 to 3 months of age, 20 to 25.1 g) (Charles River, Strain code:027). All procedures were performed under general anesthesia (20 mg/kg ketamine ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primiparous breeder dams and males were obtained from a commercial breeder (Study 1 and 2: C57Bl/6JOlaHsd, Envigo, The Netherlands; Study 3: C57Bl/6J, Charles River Laboratories, Germany). Prior to breeding ...
-
bioRxiv - Neuroscience 2022Quote: Experiments were carried out with male Lister Hooded rats (3 months old, 250-300 g at the beginning of the experiments) provided by an authorized supplier (Charles River Laboratories, Barcelona, Spain). Upon their arrival at Pablo de Olavide Animal House (Seville ...
-
bioRxiv - Immunology 2022Quote: ... The co-cultures were incubated for 2 or 3 days before inoculation into 8- or 9-day-old specific pathogen free (SPF) embryonated chicken eggs (Charles River Laboratories, CT, USA). To inoculate eggs ...
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Neuroscience 2020Quote: We applied a modified repeated SDS model [3] for 14 consecutive days using male Sprague Dawley (SD) rats that were approximately 8 weeks old (Charles River Laboratories Japan, Yokohama, Japan) at stress onset ...
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Molecular Biology 2024Quote: In vivo immunogenicity of gB protein in combination with adjuvants was evaluated in 6–8 week old BALB/c mice (Charles River) at Aragen Bioscience (Morgan Hill ...
-
bioRxiv - Bioengineering 2020Quote: Sprague-Dawley rats were obtained for the 20 weeks (n = 33, Harlan Laboratories, 7 weeks old; males only) and the 10 weeks experiments (n = 21, Charles River Laboratories, 3 weeks old; males only), and randomly assigned to each treatment ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...