Labshake search
Citations for Charles River Labs :
151 - 200 of 217 citations for Mouse Anti Hepatitis B Virus X Protein Antibody 1884 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: Cortical neuron cultures were prepared either from wild-type CD1 mouse embryos purchased from Charles River or from heterozygous crosses between PFTK1 mice ...
-
bioRxiv - Molecular Biology 2022Quote: ... Each rAAV were test in separate B6 albino mouse (B6N-Tyrc-Brd/BrdCrCrl, Charles River, MA) through retro-orbital injection ...
-
bioRxiv - Physiology 2023Quote: ... Female BALB/cByJ (age 5-8 weeks; weight ≈20g per mouse) were acquired from Charles River® Laboratories (Barcelona ...
-
bioRxiv - Immunology 2023Quote: ... 1-cell stage mouse embryos and then implanted into surrogate CD-1 mice (Charles River Laboratories). Pups born were screened for presence of the targeted allele and analyzed for proper expression ...
-
bioRxiv - Immunology 2023Quote: ... OT-1s are tested via PCR for a comprehensive list of mouse pathogens by Charles River Laboratory Testing Management ...
-
bioRxiv - Physiology 2024Quote: All mouse experiments were carried out in C57BL/6 male mice purchased from Charles River (Germany). Mice were housed in groups of 4 in ventilated cages with a 12 h light/12 h dark cycle in a temperature-controlled (20-24°C ...
-
bioRxiv - Microbiology 2024Quote: Mouse Model: Five- to six-week-old female C57BL/6J mice were acquired from Charles River Laboratories ...
-
bioRxiv - Biophysics 2024Quote: ... Pancreatic spheres were prepared from the dissection of E13.5 embryos (mouse CD1 from Charles River Laboratory) using the protocol reported in Greggio et al38 and used without passaging.
-
bioRxiv - Immunology 2020Quote: ... Recombinant proteins were tested for LPS content by the chromogenic Limulus amebocyte lysate assay (Endochrome; Charles River), and the endotoxin content was less than 0.01 U per microgram of recombinant proteins.
-
bioRxiv - Cell Biology 2020Quote: Mouse eyes were collected from male and female 12-week-old CD1 mice obtained from Charles River Laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse primary cortical neuron cultures were prepared from gestational day 15 C57BL/6 embryos (Charles River Laboratories), as described previously (Zheng 2010) ...
-
bioRxiv - Developmental Biology 2019Quote: Mouse oocytes were collected at the germinal vesicle stage from the ovaries of CD1 females (Charles River) aged ∼3months ...
-
bioRxiv - Cancer Biology 2019Quote: ... after which 200 μL were injected into the tail vein of a Balb/c mouse (Charles River). Mice were anesthetized with isoflurane immediately after injection and terminal cardiac blood collection was performed ...
-
bioRxiv - Bioengineering 2019Quote: An 8-week-old nude female mouse (nu/nu, strain code: 088, Charles River Laboratories, MA, USA) was used to test needle guidance with GNR injection using a well-defined protocol ...
-
bioRxiv - Genetics 2021Quote: All null allele mouse lines were produced in the C57BL/6N strain background available from Charles River, the Jackson Laboratory ...
-
bioRxiv - Genetics 2020Quote: All mouse experiments were performed with C57BL/6J mice obtained from Charles River (Charles River Laboratories, France). All mice were housed in a temperature-controlled system and maintained on a 12-h light/dark cycle (lights on at 7 a.m.) ...
-
bioRxiv - Neuroscience 2022Quote: ... Outbred strain CD1 mouse pups used for some in utero electroporation experiments were ordered from Charles River Laboratories (Wilmington ...
-
bioRxiv - Immunology 2023Quote: ... Mouse models carrying orthologous mutations of SLE patients were generated in C57BL/6 mice (Charles River Laboratories) via CRISPR-Cas9 genome editing technology according to Jiang et al ...
-
bioRxiv - Neuroscience 2023Quote: ... All CPN were isolated and purified from wildtype CD1 mouse pups of both sexes (Charles River Laboratories), enabling subtype-specific expression of fluorescent proteins using unilateral in utero electroporation at embryonic day 14.5 (E14.5) ...
-
bioRxiv - Bioengineering 2023Quote: ... For the immunogenic protein challenge experiments 9 week old female Balb/c mice were purchased from Charles River Laboratory.
-
bioRxiv - Genomics 2020Quote: ... Wild-type mouse strains were bred from stocks in-house or otherwise supplied by Charles River (L’Arbresle, France) or MRC Harwell ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2.5 × 105 cells/mouse) were injected into the subcutaneous flank of female Balb/c mice (Charles River Labs). Tumors were allowed to grow to 50-100 mm3 in size for inclusion in the study ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cell line was screened for the presence of mycoplasma and mouse pathogens (at Charles River Laboratories, USA) before culturing and never cultured for more than five passages.
-
bioRxiv - Developmental Biology 2021Quote: ChIP-seq was performed using dissected whole lungs from E14.5 CD-1 mouse embryos obtained from Charles River. Chromatin was prepared as previously described (Steimle et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse submandibular salivary glands (SMGs) were dissected from timed-pregnant female mice (strain CD-1, Charles River Laboratories) at embryonic day 14 (E14) ...
-
bioRxiv - Genetics 2022Quote: ... the mouse oocytes were collected from 4-5-week-old C57BL/6N females’ mice (purchased from Charles River), In addition ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was injected into the amniotic cavity of embryonic day (E) 9 CD1/NCrl mouse embryos (Charles River Labs). Injections were carried out under ultra-sound guidance using the Vevo 2100 ultrasound imaging system (Visualsonics ...
-
bioRxiv - Developmental Biology 2023Quote: Mouse oocytes were collected at the GV stage from the ovaries of CD1 females (Charles River Crl:CD1(ICR) 022 ...
-
bioRxiv - Cell Biology 2024Quote: Mouse embryonic fibroblasts (MEFs) were prepared from 12.5-day-old embryos of OF1 or DR4 mice (Charles River). Conventional rabbit iPSCs B19 ...
-
bioRxiv - Cancer Biology 2024Quote: FFPE tumor sections from nine different patient-derived ICC xenograft (PDX) mouse models were provided by Charles River Germany (am Flughafen 12-14 ...
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-p27 (Charles River Laboratories, 1:1000) and mouse anti-TOX3 (Novus Bio ...
-
bioRxiv - Neuroscience 2020Quote: The following mouse strains/lines were used in this study: CD-1® IGS (Charles River Laboratories, Stock # 022); C57BL/6J (The Jackson Laboratory ...
-
bioRxiv - Immunology 2020Quote: ... C57BL/6 and OT-I laboratory mouse strains were bred in house at LSHTM or purchased from Charles River Laboratories (Margate ...
-
bioRxiv - Biochemistry 2023Quote: Primary neuronal cultures were obtained from cerebral cortex of mouse embryos at gestation day 14–16 (Charles River Laboratories). The neurons were dissociated using Papain Dissociation System (Worthington Biochemical Corporation ...
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Cancer Biology 2019Quote: ... The specific pathogen free status of these cells was confirmed by PCR screening for mouse/rat comprehensive panel (Charles River). MC38 ...
-
bioRxiv - Molecular Biology 2021Quote: Collection of GAM data from dopaminergic neurons was performed using one C57Bl/6NCrl (RRID: IMSR_CR:027; WT) mouse which were purchased from Charles River, and from one TH-GFP (B6.Cg-Tg(TH-GFP)21-31/C57B6 ...
-
bioRxiv - Molecular Biology 2024Quote: In vivo immunogenicity of gB protein in combination with adjuvants was evaluated in 6–8 week old BALB/c mice (Charles River) at Aragen Bioscience (Morgan Hill ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5×106 Trp53-/-ID8 cells/mouse were injected intraperitoneally (IP) in 6-week-old C57BL/6J female mice (Charles River, UK). At defined endpoint ...
-
bioRxiv - Neuroscience 2019Quote: ... For genes related to spatial distribution ISH was performed on tissue sections from wild type mouse brains (C57BL/6, Charles River). Adult mice were transcardially perfused with 1x PBS followed by 4% paraformaldehyde and post-fixation in 4%PFA overnight ...
-
bioRxiv - Immunology 2019Quote: ... Pb ANKA and Pb K173 stabilates were subjected to a Mouse/Rat Comprehensive Clear Panel for PCR infectious agent testing (PRIA, Charles River). Further detection and quantitation of LDV particles were done with a simple PCR LDV test (Charles River ...
-
bioRxiv - Microbiology 2021Quote: ... Six to wight week old female C57BL/6 mice were housed (n=10) and the mouse-adapted influenza strainsA/PR/8/34 (H1N1;PR8) were provided by Charles River Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: Sound-evoked neuronal responses were obtained via chronically-implanted electrodes in the right hemisphere auditory cortex of one 17-week-old male mouse (M. musculus, C57Bl/6, Charles River). All experimental procedures were carried out in accordance with the institutional animal welfare guidelines and a UK Home OZce Project License approved under the United Kingdom Animals (Scienti1c Procedures ...
-
bioRxiv - Genetics 2020Quote: ... approximately 15/mouse) into the fallopian tubes of CD1 female recipients rendered pseudopregnant by mating with B6C3F1 vasectomized males (purchased from Charles River).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Bone marrow derived cells (BMDCs) were obtained from a minimal-disease certified mouse (C57BL/6 -M. musculus- -B6-, Charles River, US). Femurs and tibias were dissected from the euthanised mouse and ...
-
bioRxiv - Microbiology 2020Quote: ... and were bred and maintained at VRI in a vivarium free from >40 murine pathogens as determined through biannual nucleic acid testing (Mouse Surveillance Plus PRIA; Charles River) of sentinel mice exposed to mixed bedding ...
-
bioRxiv - Physiology 2022Quote: Mouse-adapted IAV A/Puerto Rico/8/934 (H1N1) was propagated in 8-day old embryonated chicken eggs (Charles River Laboratories), diluted in DPBS containing Ca2+ and Mg2+ ...