Labshake search
Citations for Charles River Labs :
101 - 150 of 264 citations for Recombinant Mouse Dickkopf Homolog 3 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... For each male SCID/Beige mouse (7-week old; Charles River), 100 μL mixture was subcutaneously injected into both flanks ...
-
bioRxiv - Microbiology 2021Quote: ... three- to five-day-old mouse neonates (Charles River, Wilmington, MA) were orogastrically infected with approximately 106 bacterial cells following 2 hours of separation from dam mice and maintained at 30°C for 20h ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A Male Balb/C mouse weighing 25 g (Charles River, UK), allowed free access to standard rodent chow and water ...
-
bioRxiv - Microbiology 2019Quote: ... Bacteria were opsonized with 10% BALB/c mouse serum (Charles River) in 10 volumes of DMEM for 30 min on ice ...
-
bioRxiv - Microbiology 2022Quote: ... bacteria were opsonised with 10% BALB/c mouse serum (Charles River) in 10 volumes of DMEM for 30 min on ice.
-
bioRxiv - Cancer Biology 2023Quote: ... For each male SCID/Beige mouse (7-weeks-old; Charles River #CRL:250 ...
-
bioRxiv - Neuroscience 2024Quote: ... we used the following mouse lines: CD1 (ICR) (Charles River: 022) and Ai14 (Jackson Labs ...
-
bioRxiv - Bioengineering 2019Quote: ... Twelve Sprague Dawley female rats (Charles River, 3 to 6 months old, 250 to 500 g) were housed in a 12:12 h reverse light-dark cycle ...
-
bioRxiv - Developmental Biology 2019Quote: C57BL/6J mice at 3-months old were purchased from a breeder (Charles River Laboratories, Japan). Some mice were raised up to 5- or 12-months old at Institute for Animal Experimentation Tohoku University Graduate School of Medicine and used for histological and semi-quantitative analyses ...
-
bioRxiv - Molecular Biology 2021Quote: ... male and female B6SV129F1 wild-type mice of 3-6 months of age (Charles River Laboratories). Cre-responsive Rosa26-TdTomato (R26-TdT ...
-
bioRxiv - Neuroscience 2021Quote: Layer 2/3 pyramidal neurons in the visual cortex of mice (C57BI/6NCrl; Charles River Laboratories) were sparsely labeled with the indicators – either Voltron525-ST or Voltron2525-ST ...
-
bioRxiv - Neuroscience 2021Quote: Adult male Long-Evans rats were obtained at 3-4 months of age from Charles River Laboratories (Raleigh ...
-
bioRxiv - Neuroscience 2023Quote: Young (3-4m) and aged (15m) old C57BL/6J female mice were acquired from Charles River Laboratories ...
-
bioRxiv - Biophysics 2024Quote: ... The animals investigated at USC were 3-8 months-old female Wistar-Kyoto rats (Charles River), and the animals investigated at Helmholtz/TUM were 8-week-old female Wistar rats (Charles River ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Experiments were performed on outbred strain CD1 mouse pups (Charles River Laboratories). Analyses are thought to include animals of both sexes at approximately equal proportions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mouse experiments: 6-8 weeks-old female BalB/c mice (Charles River) were used in all experiments ...
-
bioRxiv - Neuroscience 2021Quote: The C57BL/6J mouse line was used as background strain (Charles River). Mice expressing Cre from the Pitx3 locus and Cre induced YFP from the Rosa26 were previously described (35 ...
-
bioRxiv - Neuroscience 2022Quote: Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17 ...
-
bioRxiv - Neuroscience 2022Quote: Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17 ...
-
bioRxiv - Immunology 2023Quote: ... B6.SJL-PtprcaPepcb/BoyCrl (CD45.1) mouse stain was obtained from Charles River Laboratory ...
-
bioRxiv - Neuroscience 2023Quote: Primary DRGs were cultured from E13.5 CD1 mouse embryos (Charles River Laboratories). DRGs were dissected in DMEM ...
-
bioRxiv - Cell Biology 2024Quote: The mouse strains used in this study were purchased from Charles River Laboratories (ICR mice ...
-
bioRxiv - Cancer Biology 2021Quote: Tumour growth on chicken embryo chorioallantoic membranes (CAMs)3 or Balb/c nude mice (Charles River, #490) was performed as described previously29 ...
-
bioRxiv - Neuroscience 2019Quote: ... Male 10 week-old Sprague-Dawley rats (n = 3, 450 grams, RRID:RGD_734476) were purchased from Charles River Laboratories (RRID:SCR_003792 ...
-
bioRxiv - Bioengineering 2019Quote: ... Four New Zealand white male rabbits (Charles River, 3 to 6 months old, 2 to 4 kg) were housed in a 12:12 h light-dark cycle ...
-
bioRxiv - Neuroscience 2020Quote: Nine Long-Evans rats (weight: 175-200g, 3 females; 6 males) rats were obtained from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2019Quote: Primary neocortical neurons were dissected from neocortex of 3 E18 Sprague-Dawley rat embryos (Charles River Laboratories). Pregnant dams were euthanized by CO 2 according to approved Boston University Institutional animal care and use (IACUC ...
-
bioRxiv - Neuroscience 2020Quote: Organotypic entorhino-hippocampal tissue cultures were prepared at postnatal day 3–5 from C57BL/6J (Charles River) and heterozygous C57BL/6-Tg(TNFa-eGFP ...
-
bioRxiv - Neuroscience 2019Quote: 51 wild type male c57BL/6 mice (2-3 months of age; Charles River Labs, Wilmington, MA) weighing 18-25g at the time of arrival were housed in groups of 2-5 mice per cage ...
-
bioRxiv - Developmental Biology 2022Quote: ... About 3 x 106 reaggregated clusters were transplanted into male C57BL/6 mice kidney capsules (Charles River). For the cytokine co-transplantation assay ...
-
bioRxiv - Neuroscience 2022Quote: ... Behavioral studies were conducted using 5 female rats (3 Long Evans and 2 Sprague Dawley, Charles River Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: Male Sprague-Dawley rats (3-month-old, n=65) were purchased from Charles River (Worcester, MA, USA). Rats were housed under controlled lighting conditions with standard animal chow and water available ad libitum ...
-
bioRxiv - Neuroscience 2022Quote: Adult male and female Balb/C mice (F0; approximately 3 months of age) purchased from Charles River were used to generate offspring for these studies ...
-
bioRxiv - Developmental Biology 2023Quote: C57BL/6J mice at 3 months of age were purchased from a breeder (Charles River Laboratories, Japan) and were raised to 12 or 20 months old at the Institute for Animal Experimentation at the Tohoku University Graduate School of Medicine ...
-
bioRxiv - Neuroscience 2022Quote: In this study we used outbred CD1 adult (3 months old) male and female mice (Charles River, Italy) housed in groups of 3-5 subjects.
-
bioRxiv - Neuroscience 2022Quote: ... Experimental subjects were female Long Evans rats 3- to 8-months at the start of training (Charles River).
-
bioRxiv - Neuroscience 2022Quote: Adult Mongolian gerbils (Meriones unguiculatus, n = 5, 3 males) were weaned from commercially obtained breeding pairs (Charles River). Animals were housed on a 12 h light/12 h dark cycle and provided with ad libitum food and water unless otherwise noted ...
-
bioRxiv - Neuroscience 2023Quote: Male C57BL/6 adult mice (n = 57; 3-5-month-old; 28-35 g) were used (Charles River). Before surgery ...
-
bioRxiv - Neuroscience 2023Quote: ... Experimental subjects were female Long Evans rats 3-to 8-months at the start of training (Charles River).
-
bioRxiv - Neuroscience 2024Quote: ... were placed in the home cage of adult male CD1 mice (3-10 months of age, Charles River), which had been prescreened for aggression prior to encountering the subject mice ...
-
bioRxiv - Neuroscience 2020Quote: ... Embryos (aged E12.5 - E16.5) of the mouse strain ICR (CD1, Charles River Laboratory) were used for in utero experiments and primary culture ...
-
bioRxiv - Neuroscience 2019Quote: Hippocampal neuronal cultures were prepared from C57BL/6J mouse embryos (Charles River Laboratories). UPF2-shRNA 1 virus is on a piLenti-shRNA-GFP backbone carrying one shRNA against the UPF2 mRNA (AGGCGTATTCTGCACTCTAAAGGCGAGCT) ...
-
bioRxiv - Neuroscience 2020Quote: ... Hippocampi were isolated from postnatal day 0 (P0) CD-1 mouse (Charles River) brain tissues and digested with 10U/mL papain (Worthington Biochemical Corp ...
-
bioRxiv - Neuroscience 2021Quote: ... DRG was dissected from embryonic days 13.5-14.5 CD1 mouse (Charles River Laboratories) and incubated with 0.05% Trypsin solution at 37 °C for 20 minutes ...
-
bioRxiv - Physiology 2024Quote: The following mouse strains were used in this study: C57BL/6 (Charles River), Sirt2flox 57 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3×106 exponentially growing Capan-1 cells were subcutaneously in Nude/balbc Mice (Charles River, 9 weeks old, females). After 1 week implantation ...
-
bioRxiv - Physiology 2022Quote: Neonatal rat cardiomyocytes (NRCM) were isolated from ∼3-day-old pups from Sprague- Dawley rats (Charles River, Stock 001) following standard protocols using the Worthington Neonatal Cardiomyocyte Isolation System (Worthington ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primary rat cardiomyocytes were isolated from 1-3 day old Sprague-Dawley rats (Charles River Laboratories, St-Constant, Quebec) as previously described with minor modifications (78) ...
-
bioRxiv - Physiology 2021Quote: Adult male Sprague-Dawley rats (aged 3 to 4 months; 300–325 □g; Charles River, Saint Constant, Quebec, Canada) were randomly assigned to either a fluid percussion TBI surgery or control treatment ...
-
bioRxiv - Physiology 2020Quote: CD® IGS (International Genetic Standard) rats (all males; age 3 mo upon arrival) were purchased from Charles River Laboratories International ...