Labshake search
Citations for Charles River Labs :
101 - 150 of 515 citations for Mouse Tyrosinase Related Protein 1 TYRP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... All CPN were isolated and purified from wildtype CD1 mouse pups of both sexes (Charles River Laboratories), enabling subtype-specific expression of fluorescent proteins using unilateral in utero electroporation at embryonic day 14.5 (E14.5) ...
-
bioRxiv - Bioengineering 2023Quote: ... For the immunogenic protein challenge experiments 9 week old female Balb/c mice were purchased from Charles River Laboratory.
-
bioRxiv - Genomics 2020Quote: ... Wild-type mouse strains were bred from stocks in-house or otherwise supplied by Charles River (L’Arbresle, France) or MRC Harwell ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2.5 × 105 cells/mouse) were injected into the subcutaneous flank of female Balb/c mice (Charles River Labs). Tumors were allowed to grow to 50-100 mm3 in size for inclusion in the study ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cell line was screened for the presence of mycoplasma and mouse pathogens (at Charles River Laboratories, USA) before culturing and never cultured for more than five passages.
-
bioRxiv - Genetics 2022Quote: ... the mouse oocytes were collected from 4-5-week-old C57BL/6N females’ mice (purchased from Charles River), In addition ...
-
bioRxiv - Immunology 2020Quote: ... Mice were infected with the mouse adapted influenza virus A/Puerto Rico/8/34 (H1N1) (PR8) (Charles River Laboratories Avian Vaccine Services ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was injected into the amniotic cavity of embryonic day (E) 9 CD1/NCrl mouse embryos (Charles River Labs). Injections were carried out under ultra-sound guidance using the Vevo 2100 ultrasound imaging system (Visualsonics ...
-
bioRxiv - Developmental Biology 2023Quote: Mouse oocytes were collected at the GV stage from the ovaries of CD1 females (Charles River Crl:CD1(ICR) 022 ...
-
bioRxiv - Cell Biology 2024Quote: Mouse embryonic fibroblasts (MEFs) were prepared from 12.5-day-old embryos of OF1 or DR4 mice (Charles River). Conventional rabbit iPSCs B19 ...
-
bioRxiv - Cancer Biology 2024Quote: FFPE tumor sections from nine different patient-derived ICC xenograft (PDX) mouse models were provided by Charles River Germany (am Flughafen 12-14 ...
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Developmental Biology 2019Quote: ... CD-1 (Charles River) was used to generate knockout mice ...
-
bioRxiv - Developmental Biology 2019Quote: ... CD-1 (Charles River) and Coq10a-/- mouse lines were maintained according to the University of California ...
-
bioRxiv - Cell Biology 2019Quote: CD-1 (Charles River) or C57BL/6 (JAX #000664) ...
-
bioRxiv - Developmental Biology 2019Quote: ... CD-1 (Charles River), Myh6-Cre (20) ...
-
bioRxiv - Immunology 2020Quote: ... C57BL/6 and OT-I laboratory mouse strains were bred in house at LSHTM or purchased from Charles River Laboratories (Margate ...
-
bioRxiv - Biochemistry 2023Quote: Primary neuronal cultures were obtained from cerebral cortex of mouse embryos at gestation day 14–16 (Charles River Laboratories). The neurons were dissociated using Papain Dissociation System (Worthington Biochemical Corporation ...
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Pathology 2023Quote: CD-1 (CD-1; strain #022) outbred mice were purchased from Charles River Laboratories ...
-
bioRxiv - Cancer Biology 2019Quote: ... The specific pathogen free status of these cells was confirmed by PCR screening for mouse/rat comprehensive panel (Charles River). MC38 ...
-
bioRxiv - Molecular Biology 2021Quote: Collection of GAM data from dopaminergic neurons was performed using one C57Bl/6NCrl (RRID: IMSR_CR:027; WT) mouse which were purchased from Charles River, and from one TH-GFP (B6.Cg-Tg(TH-GFP)21-31/C57B6 ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Molecular Biology 2024Quote: In vivo immunogenicity of gB protein in combination with adjuvants was evaluated in 6–8 week old BALB/c mice (Charles River) at Aragen Bioscience (Morgan Hill ...
-
bioRxiv - Microbiology 2020Quote: ... male mice were paired with 1 to 2 CD-1 female mice (Charles River) each night beginning at day 5 post infection ...
-
bioRxiv - Developmental Biology 2021Quote: CD-1 mice (Charles River) were used for wild-type expression and ex vivo organ culture studies ...
-
bioRxiv - Neuroscience 2019Quote: ... CD-1 mice (Charles River). Briefly ...
-
bioRxiv - Physiology 2021Quote: ... CD-1 (Charles River Labs), and NIH-Swiss (Envigo ...
-
bioRxiv - Neuroscience 2022Quote: CD-1 mice (Charles River) were used to produce WT mouse cortical neuron cultures as shown previously (Sathler et al. ...
-
bioRxiv - Biochemistry 2021Quote: CF-1 MEFs (Charles River) were transduced with inducible S TEMCCA and rtTA lentivirus-containing supernatants overnight in 8 μg/ml polybrene (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... CD-1 (Charles River Laboratories), or human transferrin receptor KI ...
-
bioRxiv - Neuroscience 2023Quote: ... and CD-1 (Charles River Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: ... CD-1 (Charles River Laboratories), or Sarm1-deficient mice (B6 ...
-
bioRxiv - Neuroscience 2023Quote: ... Adult CD-1 male mice and pregnant CD-1 dams were obtained from Charles River Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5×106 Trp53-/-ID8 cells/mouse were injected intraperitoneally (IP) in 6-week-old C57BL/6J female mice (Charles River, UK). At defined endpoint ...
-
bioRxiv - Immunology 2019Quote: ... Pb ANKA and Pb K173 stabilates were subjected to a Mouse/Rat Comprehensive Clear Panel for PCR infectious agent testing (PRIA, Charles River). Further detection and quantitation of LDV particles were done with a simple PCR LDV test (Charles River ...
-
bioRxiv - Microbiology 2021Quote: ... Six to wight week old female C57BL/6 mice were housed (n=10) and the mouse-adapted influenza strainsA/PR/8/34 (H1N1;PR8) were provided by Charles River Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: Sound-evoked neuronal responses were obtained via chronically-implanted electrodes in the right hemisphere auditory cortex of one 17-week-old male mouse (M. musculus, C57Bl/6, Charles River). All experimental procedures were carried out in accordance with the institutional animal welfare guidelines and a UK Home OZce Project License approved under the United Kingdom Animals (Scienti1c Procedures ...
-
bioRxiv - Genetics 2020Quote: ... approximately 15/mouse) into the fallopian tubes of CD1 female recipients rendered pseudopregnant by mating with B6C3F1 vasectomized males (purchased from Charles River).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Bone marrow derived cells (BMDCs) were obtained from a minimal-disease certified mouse (C57BL/6 -M. musculus- -B6-, Charles River, US). Femurs and tibias were dissected from the euthanised mouse and ...
-
bioRxiv - Microbiology 2020Quote: ... and were bred and maintained at VRI in a vivarium free from >40 murine pathogens as determined through biannual nucleic acid testing (Mouse Surveillance Plus PRIA; Charles River) of sentinel mice exposed to mixed bedding ...
-
bioRxiv - Physiology 2022Quote: Mouse-adapted IAV A/Puerto Rico/8/934 (H1N1) was propagated in 8-day old embryonated chicken eggs (Charles River Laboratories), diluted in DPBS containing Ca2+ and Mg2+ ...
-
bioRxiv - Neuroscience 2023Quote: Preparation and maintenance of dissociated spinal cord-DRG cultures from E13 CD1 mouse embryos (Charles River Laboratories, St. Constant, QC, Canada) were as previously described [22] ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Strain CRL:CD-1(ICR) ;CD-1) male and female breeder mice were obtained from Charles River Laboratories (Raleigh ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... high-titer of lentiviral particles (mECE20 mixed with mCherry which allows the visualization of infected mice at harvest) were delivered into the amniotic cavity of embryonic day (E) 9 CD1/NCrl mouse embryos (Charles River Labs). Injections were performed under ultra-sound guidance using the Vevo 2100 ultrasound imaging system (Visualsonics ...
-
bioRxiv - Bioengineering 2022Quote: Cortical neurons and glial cells were harvested from the cortical hemispheres dissected from C57BL/6 mouse embryo brains at E15-16 (Charles River Laboratories). Pregnant mice were euthanized by cervical dislocation ...
-
bioRxiv - Biochemistry 2023Quote: Cortical neuron cultures were established from neonatal mouse brains (wild-type C57BL/6, Charles River, strain code 027, or the genotype(s) indicated for each experiment ...