Labshake search
Citations for Charles River Labs :
101 - 150 of 189 citations for Mouse Anti Rift Valley Fever Virus Nucleoprotein Antibody AA11 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: The mouse strains used in this study were purchased from Charles River Laboratories (ICR mice ...
-
bioRxiv - Neuroscience 2020Quote: ... Embryos (aged E12.5 - E16.5) of the mouse strain ICR (CD1, Charles River Laboratory) were used for in utero experiments and primary culture ...
-
bioRxiv - Neuroscience 2019Quote: Hippocampal neuronal cultures were prepared from C57BL/6J mouse embryos (Charles River Laboratories). UPF2-shRNA 1 virus is on a piLenti-shRNA-GFP backbone carrying one shRNA against the UPF2 mRNA (AGGCGTATTCTGCACTCTAAAGGCGAGCT) ...
-
bioRxiv - Neuroscience 2020Quote: ... Hippocampi were isolated from postnatal day 0 (P0) CD-1 mouse (Charles River) brain tissues and digested with 10U/mL papain (Worthington Biochemical Corp ...
-
bioRxiv - Neuroscience 2021Quote: ... DRG was dissected from embryonic days 13.5-14.5 CD1 mouse (Charles River Laboratories) and incubated with 0.05% Trypsin solution at 37 °C for 20 minutes ...
-
bioRxiv - Physiology 2024Quote: The following mouse strains were used in this study: C57BL/6 (Charles River), Sirt2flox 57 ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary mouse myoblasts (mskMPs) from 3-week-old C57Bl6/J (Charles River, C57BL/6NCrl) mice were maintained in collagen I coated dishes (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... All mouse lines were in the C57BL/6J background (>10 generations, Charles River, USA), besides Scn1a+/− mice that were in a mixed background (C57BL/6J-CD1 85:15%).
-
bioRxiv - Neuroscience 2021Quote: ... Biological specimens for imaging were obtained from a C57Bl6 mouse (Charles River Labs, UK) expressing mCherry sparsely in neurons of the Lateral Posterior nucleus (LP ...
-
bioRxiv - Neuroscience 2021Quote: ... The following mouse strains were used: wild type (C57BL/6N, Charles River Laboratories #027), Ai14 (JAX ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... and the resident was a white coat-coloured CD-1 mouse (Charles River, #022). For the rat resident-intruder protocol ...
-
bioRxiv - Genetics 2020Quote: ... We isolated mouse connective tissue from 8–10 week old CD1 mice (Charles River), intervertebral discs (IVDs ...
-
bioRxiv - Cell Biology 2022Quote: Mouse lines used for time-course experiments: C57BL/6 wild type (Charles River Laboratories), one 12 weeks old male and one 8 weeks female mice.
-
bioRxiv - Developmental Biology 2021Quote: ... All other mouse experiments were performed on WT CD1 mice (Mus musculus, Charles River Laboratories).
-
bioRxiv - Neuroscience 2020Quote: ... WT mice used for backcrossing and mouse amplification are C57Bl6/J mice from Charles River Laboratories (L’Arbresle ...
-
bioRxiv - Cancer Biology 2022Quote: ... two-month old hairless albino mice (SKH1-Elite Mouse 477; Charles River Labs, Wilmington, MA) were divided into eight groups of 12 mice by sex ...
-
bioRxiv - Neuroscience 2021Quote: ... We used the following mouse lines in this study: Crl: CD1 (ICR) (Charles River: 022), Ai14 (Jackson Labs ...
-
bioRxiv - Neuroscience 2019Quote: ... unfixed tissue sections (12 µm) of mouse (P60-P70; Charles River, C57BL/6; n = 2), marmoset (n = 2) ...
-
bioRxiv - Developmental Biology 2021Quote: The following mouse strains were used: C57BL/6 (C57BL/6NCrl, Charles River Laboratories, strain 027) was the wild-type strain ...
-
bioRxiv - Microbiology 2020Quote: Mouse experiments were performed with Female Swiss OF1 mice (6-7 weeks old; Charles River. All animal experiments were granted a licence by the Competent Authority after an advice on the ethical evaluation by the Animal Experiments Committee Leiden (AVD1160020173304) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Wild-type mouse neonates were obtained from timed pregnant CD1 mice (Charles River Laboratories, #022). All animal studies were approved by the Administrative Panel on Laboratory Animal Care (APLAC ...
-
bioRxiv - Cell Biology 2023Quote: Hippocampal Primary neurons were isolated from E17-E19 C57BL/6 mouse brains (Charles River Laboratories) as described in Seibenhener et al (85) ...
-
bioRxiv - Neuroscience 2023Quote: ... hippocampi were dissected from postnatal (P0-3) CD1 mouse or Sprague-Dawley rat (Charles River) pups were dissociated and plated with growth media ...
-
bioRxiv - Microbiology 2024Quote: Mouse fecal samples were collected from nine female C3H/HeN mice purchased from Charles River Laboratories ...
-
bioRxiv - Developmental Biology 2021Quote: Early mouse embryos were isolated at E5.5 (from pregnant CD1 females, purchased from Charles River, UK). Following dissection from the decidua ...
-
bioRxiv - Microbiology 2021Quote: Mouse Model: Five- to six-week-old female C57BL/6J mice were acquired from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: Cerebral cortices from post-natal day 6 or 7 (P6/P7) CD1 mouse pups (Charles River) were collected ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mouse lines used in this study were: wild type (CD1, Charles River Laboratories, Strain Code #022), Cxcl12fl/fl (The Jackson Laboratory ...
-
bioRxiv - Molecular Biology 2020Quote: All mouse experiments were performed with female NMRI or C57BL/6 mice purchased from Charles River Laboratories (Sulzfeld ...
-
bioRxiv - Cancer Biology 2021Quote: ... Routine human and mouse pathogen screening was performed on original and passaged tissue by Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2020Quote: ... The mouse lines used in this study include CFW mice (Strain code 024, Charles River Laboratories), a βII-Specflox/flox mouse line27 ...
-
bioRxiv - Neuroscience 2022Quote: Cortical neuron cultures were prepared either from wild-type CD1 mouse embryos purchased from Charles River or from heterozygous crosses between PFTK1 mice ...
-
bioRxiv - Molecular Biology 2022Quote: ... Each rAAV were test in separate B6 albino mouse (B6N-Tyrc-Brd/BrdCrCrl, Charles River, MA) through retro-orbital injection ...
-
bioRxiv - Physiology 2023Quote: ... Female BALB/cByJ (age 5-8 weeks; weight ≈20g per mouse) were acquired from Charles River® Laboratories (Barcelona ...
-
bioRxiv - Immunology 2023Quote: ... 1-cell stage mouse embryos and then implanted into surrogate CD-1 mice (Charles River Laboratories). Pups born were screened for presence of the targeted allele and analyzed for proper expression ...
-
bioRxiv - Immunology 2023Quote: ... OT-1s are tested via PCR for a comprehensive list of mouse pathogens by Charles River Laboratory Testing Management ...
-
bioRxiv - Physiology 2024Quote: All mouse experiments were carried out in C57BL/6 male mice purchased from Charles River (Germany). Mice were housed in groups of 4 in ventilated cages with a 12 h light/12 h dark cycle in a temperature-controlled (20-24°C ...
-
bioRxiv - Biophysics 2024Quote: ... Pancreatic spheres were prepared from the dissection of E13.5 embryos (mouse CD1 from Charles River Laboratory) using the protocol reported in Greggio et al38 and used without passaging.
-
bioRxiv - Microbiology 2024Quote: Mouse Model: Five- to six-week-old female C57BL/6J mice were acquired from Charles River Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: Mouse eyes were collected from male and female 12-week-old CD1 mice obtained from Charles River Laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse primary cortical neuron cultures were prepared from gestational day 15 C57BL/6 embryos (Charles River Laboratories), as described previously (Zheng 2010) ...
-
bioRxiv - Developmental Biology 2019Quote: Mouse oocytes were collected at the germinal vesicle stage from the ovaries of CD1 females (Charles River) aged ∼3months ...
-
bioRxiv - Cancer Biology 2019Quote: ... after which 200 μL were injected into the tail vein of a Balb/c mouse (Charles River). Mice were anesthetized with isoflurane immediately after injection and terminal cardiac blood collection was performed ...
-
bioRxiv - Bioengineering 2019Quote: An 8-week-old nude female mouse (nu/nu, strain code: 088, Charles River Laboratories, MA, USA) was used to test needle guidance with GNR injection using a well-defined protocol ...
-
bioRxiv - Genetics 2021Quote: All null allele mouse lines were produced in the C57BL/6N strain background available from Charles River, the Jackson Laboratory ...
-
bioRxiv - Genetics 2020Quote: All mouse experiments were performed with C57BL/6J mice obtained from Charles River (Charles River Laboratories, France). All mice were housed in a temperature-controlled system and maintained on a 12-h light/dark cycle (lights on at 7 a.m.) ...
-
bioRxiv - Neuroscience 2022Quote: ... Outbred strain CD1 mouse pups used for some in utero electroporation experiments were ordered from Charles River Laboratories (Wilmington ...
-
bioRxiv - Immunology 2023Quote: ... Mouse models carrying orthologous mutations of SLE patients were generated in C57BL/6 mice (Charles River Laboratories) via CRISPR-Cas9 genome editing technology according to Jiang et al ...
-
bioRxiv - Neuroscience 2023Quote: ... All CPN were isolated and purified from wildtype CD1 mouse pups of both sexes (Charles River Laboratories), enabling subtype-specific expression of fluorescent proteins using unilateral in utero electroporation at embryonic day 14.5 (E14.5) ...
-
bioRxiv - Genomics 2020Quote: ... Wild-type mouse strains were bred from stocks in-house or otherwise supplied by Charles River (L’Arbresle, France) or MRC Harwell ...