Labshake search
Citations for Charles River Labs :
1151 - 1171 of 1171 citations for Human Chemokine Like Factor Superfamily 6 CKLFSF6 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and 5 μL of the cell suspension were injected stereotactically into the striatum of 6–8-week-old female severe combined immunodeficient (SCID) mice (Charles River Frederick Research Model Facility) using a stereotactic device ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2020) were generated as previously described and compared to age and sex matched wild-type C57Bl/6 controls (Charles River, UK or Vital-River, China). Endothelial-specific cyclo-oxygenase-1 knockout mice (Ptgs1flox/flox ...
-
bioRxiv - Neuroscience 2023Quote: ... C57BL/6J mice (7–8 weeks old) were acquired from The Jackson Laboratories and CD1 retired breeder mice (4–6 months old) from Charles River (St. Constant, QC, Canada). A total of 82 animals were used in this study ...
-
bioRxiv - Bioengineering 2021Quote: Human embryonic kidney cells 293 stably expressing human hyperpolarization-gated cyclic nucleotide-sensitive cation channel 1 (HEK-HCN1) were obtained from Charles River (CT6114). Cells were cultured and maintained according to the online protocol by Charles River ...
-
bioRxiv - Genomics 2021Quote: ... Pregnant mare serum gonadotropin (5 units) and human chorionic gonadotropin (5 units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories) with a 48-h interval ...
-
bioRxiv - Cell Biology 2023Quote: Tumors were generated by intradermal injection of 5000 human metastatic melanoma cells (1205Lu) in anaesthetized Crl:NU(NCr)-Foxn1nu (athymic nude mice; Charles River, Rockville MD). Cells stably expressing GFP-cGas and mScarlet NLS were injected in a 1:1 mixture of Matrigel and minimal essential medium (Gibco ...
-
bioRxiv - Immunology 2022Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Plant Biology 2021Quote: Antibodies from guinea pig immunization with this purified protein product were obtained from Charles River biologics (USA).
-
bioRxiv - Microbiology 2021Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Cell Biology 2019Quote: ... Tnapcre mice (Dellavalle et al., 2011) and Tgfbr2flox/flox (Chytil et al., 2002) mice were backcrossed onto C57BL/6 mice (Charles River Laboratories Inc, Wilmington, MA, USA) and were genotyped as previously described (Dellavalle et al. ...
-
bioRxiv - Pathology 2022Quote: ... The pregnant mare serum gonadotropin (5 units) and the human chorionic gonadotropin (5 units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories, Kanagawa, Japan) with a 48h interval ...
-
bioRxiv - Developmental Biology 2021Quote: Pregnant mare serum gonadotropin (five units) and human chorionic gonadotropin (five units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories, Kanagawa, Japan) at a 48-h interval ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant proteins were tested for LPS content by the chromogenic Limulus amebocyte lysate assay (Endochrome; Charles River), and the endotoxin content was less than 0.01 U per microgram of recombinant proteins.
-
bioRxiv - Bioengineering 2023Quote: ... For the immunogenic protein challenge experiments 9 week old female Balb/c mice were purchased from Charles River Laboratory.
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...