Labshake search
Citations for Charles River Labs :
51 - 74 of 74 citations for Recombinant Chicken VEGFA Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: A/Netherlands/602/2009 (pdmH1N1) was grown in our laboratory by injection of 10-day old specific pathogen free (SPF) embryonated chicken eggs (Charles River Laboratories) at 37°C for 2 days ...
-
bioRxiv - Cancer Biology 2021Quote: ... Influenza virus A/PR/8/1934 (H1N1) expressing GFP from promoter x (PR8-GFP) was propagated in 10-day-old embryonated chicken eggs (Charles River Laboratories) for 48 hours at 37°C and tittered in MDCK cells ...
-
bioRxiv - Microbiology 2020Quote: ... Thomas Moran (Icahn School of Medicine at Mount Sinai) and stocks were propagated in 10-day-old embryonated chicken eggs (Charles River Laboratories) for 48 or 40 h ...
-
bioRxiv - Microbiology 2023Quote: ... The potential zoonotic viruses were collected by Andrew Bowman of the Ohio State University and were also propagated in embryonated chicken eggs (Charles River Laboratories) and titered on MDCK cells ...
-
bioRxiv - Microbiology 2021Quote: ... Viruses were grown and amplified in 10-day-old specific-pathogen-free research grade chicken embryos at 35°C (Charles River Laboratories; SPAEAS).
-
bioRxiv - Immunology 2024Quote: ... Cell culture supernatants containing influenza virus were harvested 7 days post-MDCK addition and blindly passaged in 8–10-day-old embryonated chicken eggs (Charles River Laboratories, Inc.). Inoculated eggs were incubated at 37°C for 48 h ...
-
bioRxiv - Immunology 2022Quote: ... The co-cultures were incubated for 2 or 3 days before inoculation into 8- or 9-day-old specific pathogen free (SPF) embryonated chicken eggs (Charles River Laboratories, CT, USA). To inoculate eggs ...
-
bioRxiv - Immunology 2022Quote: ... and A/California/07/2009 (Cal/09: H1N1) (BEI Resources) were propagated in 10-day-old specific pathogen-free embryonated chicken eggs (Charles River Laboratories Wilmington, MA) at 35°C and with 55-65% humidity ...
-
bioRxiv - Immunology 2024Quote: ... viruses were propagated by inoculation from a seed stock in 10-day-old specific pathogen-free embryonated chicken eggs (Charles River Laboratories Wilmington, MA) at 35°C with 55% - 65% humidity ...
-
bioRxiv - Immunology 2021Quote: ... the cells were washed and cultured in 48-well plates for 2 weeks supplemented with recombinant interleukin-2 (IL-2, Charles River Labs, USA) at 20 IU / mL every 2–3 days thereafter ...
-
bioRxiv - Neuroscience 2022Quote: ... They had unlimited chow (Rodent 5075, 18% protein, 4.5% fat, Charles River Laboratories) until 2 days before the commencement of food self-administration training ...
-
bioRxiv - Biophysics 2022Quote: ... 100 µL of influenza solution (viral protein concentration from Charles River ∼ 0.2 mg/mL) was mixed in 400 µL of diluted Texas Red-DHPE suspension in HB buffer and incubated at room temperature in the dark for 2 h on a rocker ...
-
bioRxiv - Immunology 2022Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Plant Biology 2021Quote: Antibodies from guinea pig immunization with this purified protein product were obtained from Charles River biologics (USA).
-
bioRxiv - Microbiology 2021Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Bioengineering 2023Quote: ... For the immunogenic protein challenge experiments 9 week old female Balb/c mice were purchased from Charles River Laboratory.
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Molecular Biology 2024Quote: In vivo immunogenicity of gB protein in combination with adjuvants was evaluated in 6–8 week old BALB/c mice (Charles River) at Aragen Bioscience (Morgan Hill ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...