Labshake search
Citations for Charles River Labs :
551 - 589 of 589 citations for Dengue Virus Serotype 1 NS1 Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... were procured from a breeding colony at the University of Florida and CD-1 laboratory mice (Mus musculus) were purchased from Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2022Quote: ... Adult male CF No 1 (CF-1) albino mice (18 - 30 g) and adult male Sprague-Dawley rats (100 -150 g) were obtained from Charles River’s facility in Kingston ...
-
bioRxiv - Neuroscience 2022Quote: Experiments were carried out on rats aged postnatal day (P) 1-2 and ‘adult’ (>P40) Sprague Dawley rats that were purchased from Charles River, UK ...
-
bioRxiv - Immunology 2022Quote: We infected mice intranasally with 30 μl of PBS containing either 1 x 103 EID50 of the Influenza A X31 strain (Charles River) or 1 x 105 PFU of Influenza A X31-OVA (kindly provided by Dr ...
-
bioRxiv - Developmental Biology 2023Quote: The following two species were used in this study: wildtype mice (Charles River; CD-1® IGS mouse, strain code 022), and wildtype rats (Charles River ...
-
bioRxiv - Developmental Biology 2023Quote: ... we generated F1 Pdgfra heterozygous mice by crossing Pdgfra heterozygous males (maintained on the original C57BL/6J background) with CD-1 (Charles River) females to improve the recovery rate of homozygous mutant KI gonads (Fig ...
-
bioRxiv - Physiology 2023Quote: Female CD-1 mice at 33 days of age and male CD-1 mice at 7 weeks of age were purchased from Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2023Quote: ... 8- to 12-week old adult female CF-1 mice (weighing from 30 to 35 g) were purchased from Charles River Laboratories and housed in the University Animal Facility ...
-
bioRxiv - Neuroscience 2024Quote: ... and five rats that were identified as significant outliers with a z-score ≥ 5 on at least one measure (n=1 F CORT Charles River, n= 2 F VEH Charles River ...
-
bioRxiv - Neuroscience 2024Quote: ... Male BALB/cJ and CD-1 mice (9-10 weeks old) weighing 30-50 g at the beginning of the experiments were purchased from Charles River Laboratories (Raleigh ...
-
bioRxiv - Neuroscience 2023Quote: All experiments were performed on 8-12 week-old male and female C57BL/6 and CD-1 mice purchased from Charles River Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... before being subcutaneously injected in one flank of 12 (n=6 mice per cell line) 6-week-old female immunodeficient NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ (NSG) mice (Charles River UK Ltd (Margate, Kent)) ...
-
bioRxiv - Cancer Biology 2021Quote: 10 million TOV21G cells infected with GFP lentivirus were injected intraperitoneally into athymic nude female mice at 6 weeks of age (Charles River Laboratories, Crl:NU(NCr)-Foxn1nu) ...
-
bioRxiv - Cancer Biology 2022Quote: ... MCF7-BM02-1 or MCF7-BM02-TAM67 were made to transplant the cells into 6-week-old female NOD.CB-17-Prkdc
/J mice (NOD/scid, Charles River Japan, Inc., Kanagawa, Japan)56,58 ... -
bioRxiv - Immunology 2022Quote: ... Brca1-/-luciferase-tagged cells in PBS were injected via intraperitoneal route in 8–10-week-old female C57BL/6 mice (Charles River Laboratories International Inc.). Imaging was started at day-7 post-cell injection ...
-
bioRxiv - Cancer Biology 2023Quote: A suspension of 100 µL PBS containing a total of 3 × 106 NCI-H460 Fluc cancer cells was injected subcutaneously into female Balb/c nu/nu mice aged 6 to 9 weeks (Charles River Laboratories, n = 20). Tumor dimensions were measured using calipers and the volume calculated using the following equation ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Retired breeder male CD-1 mice of approximately 4-8 month of age were purchased from Charles River (#022, Wilmington, MA, USA) and prescreened for aggression as previously described (22 ...
-
bioRxiv - Biochemistry 2020Quote: ... Primary rat neonatal cardiac fibroblasts were isolated from 1-3 day old Sprague-Dawley rat pups (Charles River Laboratories, St-Constant, Quebec) as previously described (Calderone et al. ...
-
bioRxiv - Cell Biology 2021Quote: Murine submandibular salivary glands were dissected as previously described 57 from embryos harvested from timed-pregnant female mice (CD-1 strain, Charles River Laboratories) at E14 ...
-
bioRxiv - Microbiology 2019Quote: ... Approximately 106 colony forming units (CFUs) in 50 µl were introduced orogastrically to 3- to 5-day-old CD-1 mice (Charles River Laboratories). Infected animals were subsequently gavaged with 50µL 10mM ethanolamine (EA ...
-
bioRxiv - Neuroscience 2022Quote: ... Brain slice electrophysiology and MEA experiments were performed on male or female CF-1 ™ mice (3-5 weeks old, Charles River). All the mice colonies were maintained in the Animal Resource Facility at Xenon Pharmaceuticals ...
-
bioRxiv - Bioengineering 2023Quote: ... 1×107 4T1 cells in 150 μL of 1×PBS were injected in the right flank region of the mice (BALB/c, female, 4-5 weeks old, Charles River, USA).
-
bioRxiv - Bioengineering 2023Quote: ... 1×107 Panc02 cells in 150 μL of 1×PBS were injected in the right flank region of the mice (C57BL/6, female, 4-5 weeks old, Charles River, USA).
-
bioRxiv - Systems Biology 2023Quote: ... The primary neurons used in this investigation are derived from embryonic litters from pregnant CD-1 mice (Charles River Laboratories, strain 022). Two pregnant mice (gestational day 17 ...
-
bioRxiv - Immunology 2024Quote: mRNA-LNP and ChAdOx-1 pre-vaccinated mouse experiments were conducted using 6-7 week old female BALB/c mice (Charles River Laboratories) with 10-14 animals in each cohort.
-
bioRxiv - Biophysics 2020Quote: ... tumour was generated by injecting 1 × 106 MDA-MB-231 cells into the lower right MFP of 4 female NOD scid gamma (NSG) mice (6-7 weeks old; Charles River Laboratories, Wilmington, MA, USA). Cells were suspended in 0.05 mL of HBSS per injection ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 5 μL of the cell suspension were injected stereotactically into the striatum of 6–8-week-old female severe combined immunodeficient (SCID) mice (Charles River Frederick Research Model Facility) using a stereotactic device ...
-
bioRxiv - Genetics 2023Quote: ... XYΔ mutant rats [SD-Del(Yp)1Mcwi (RGD:155663364)] were generated at MCW by pronuclear injection of these two CRISPR-Cas9 ribonucleoproteins targeting the sequences GCATGTGGGCAGTTTCCACCTGG and ACACAGCTCCTCTCTGGTAGAGG (protospacer adjacent motif underlined) into single-cell Crl:SD (Charles River Laboratories, Crl:SD strain code 400) embryos ...
-
bioRxiv - Developmental Biology 2022Quote: ... post-ganglionic NBPIs were surgically created in P5 wildtype female and male mice (Charles River; CD-1® IGS mouse, strain code 022) by extraforaminal nerve root excision under isoflurane anesthesia ...
-
bioRxiv - Physiology 2023Quote: Fifteen sexually mature female CD-1 mice (sacrificial age ∼ 34 weeks; mass = 44.1 ± 7.9 g) were obtained (Charles River Laboratories, Senneville, QC, Canada) with approval from the University of Guelph’s Animal Care Committee and all protocols followed CCAC guidelines ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primiparous breeder dams and males were obtained from a commercial breeder (Study 1 and 2: C57Bl/6JOlaHsd, Envigo, The Netherlands; Study 3: C57Bl/6J, Charles River Laboratories, Germany). Prior to breeding ...
-
bioRxiv - Bioengineering 2022Quote: ... Mouse fat samples were obtained from the perigonadal regions of 7- and 67-day old mice (CD-1 strain; Charles River, Wilmington, MA, USA) and directly used for lipidomics and fluorescence imaging.
-
bioRxiv - Physiology 2020Quote: White fat adipocytes were isolated from the epididymal fat pads of male CD-1 mice (fed ad libitum, 12 hr. dark/light cycle, weight 25 – 35 g; Charles River Laboratory, Kent, UK). Adipocytes were isolated by collagenase digestion as previously described (Bentley et al. ...
-
bioRxiv - Biophysics 2022Quote: Primary cortical neuron cultures were prepared from prenatal embryos of CD-1® IGS Mouse embryos (Charles River; Strain Code: 022; RRID: IMSR_CRL:022) at embryonic day 15 (E15) ...
-
bioRxiv - Cell Biology 2024Quote: ... hippocampal pruning analysis was performed on TTLL1 constitutive knock-out 14 (named here TTLL1KO; gift from Dr. C. Janke, Institut Curie, Orsay, France) backcrossed to CD-1 (Charles River, Strain Code 022) for three generations ...
-
bioRxiv - Bioengineering 2023Quote: ... We next pooled the barcoded vectors and endotoxin was determined to be <1 EU/mL using Endosafe® LAL Cartridges and the Endosafe® nexgen PTS™ device (Charles River). Pooled vector purity was assessed by staining SDS PAGE gels with GelCode™ Blue (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... and female (GRABDA2h, N =1; GRABDA2m, N = 3) Long Evans rats (Th-cre-littermates, N = 5; Gad-cre-, N = 2; Charles River Laboratories, N = 3) aged 7-9 weeks at the time of surgery were used to record dopamine release in the BLA across Pavlovian trace conditioning ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Aggressive mice used for RSDS induction were 4-8 month-old retired breeder male mice of a CD-1 background (Charles River #022, Wilmington, MA, USA). All mice were caged with corncob bedding ...
-
bioRxiv - Bioengineering 2023Quote: ... Endotoxin for both vector preparations was determined to be <1 EU/mL using Endosafe® LAL Cartridges and the Endosafe® nexgen PTS™ device (Charles River, Charleston, SC). Vector purity was assessed by silver staining of SDS PAGE gels in which 1×1010 vg of each vector was run/lane ...