Labshake search
Citations for Charles River Labs :
451 - 500 of 575 citations for Mouse Anti Human Papilloma virus type 11 711 13 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... The mouse breeders were purchased from Charles River, France (the purveyor of Jackson mice in Europe ...
-
bioRxiv - Cell Biology 2019Quote: ... BMDCs and bone marrow-derived macrophages (BMDMs) were harvested from wild-type 7-9-week-old female C57BL/6J mice or C3H/HeN mice (Charles River Canada, Montreal, QC) as previously described with minor modifications [107 ...
-
bioRxiv - Neuroscience 2019Quote: ... All behavioral tests using Auts2del8 mice were obtained by crossing Auts2del8/+ heterozygous male mice with wild type C57BL6/N female mice (Charles River Laboratories, Kanagawa, Japan) to avoid the possibility that altered behaviors in the mutant dams could influence the postnatal development of their offspring ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... AhR knock out mice (Ahr−/−) on C57BL/6 background and their C57BL/6 congenic littermates wild type (Ahr+/+) were originally supplied by Charles River (Wilmington, MA, USA). Colonies were housed under controlled temperature (22 °C ...
-
bioRxiv - Immunology 2019Quote: Animals used in the present study were 6-8 weeks old male or female wild-type C57BL/6 (Charles River Laboratories, Charleston, SC, USA), PLD1-/- or PLD2-/- mice (weighing 20-25 g) ...
-
bioRxiv - Microbiology 2023Quote: ... Rag2+/− and TCRβ+/− mice were derived in our animal facility by breeding the knockout strains to C57BL/6 wild-type mice (Charles River strain number 556). Unless otherwise specified ...
-
bioRxiv - Immunology 2021Quote: Human CD4 knock-in (hCD4KI, genOway, Lyon, France) and wildtype C57BL/6J mice (Charles River) were injected intravenously with 5 µg (∼15 MBq ...
-
bioRxiv - Developmental Biology 2020Quote: Mouse microglia were purified from CD1-IGS (Charles River) P0-P5 mouse pups ...
-
bioRxiv - Cancer Biology 2020Quote: ... estrogen supplemented (20) NCG mouse (Charles River, Wilmington, MA). Fulvestrant treatments began 7 days later with the following dosing regimen ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: A minimal-disease certified mouse (B6, Charles River, US) was killed by cervical dislocation ...
-
bioRxiv - Neuroscience 2022Quote: ... Mouse pups (C57BL/6, Charles River, PD 1-2) were anesthetized on ice ...
-
bioRxiv - Neuroscience 2022Quote: C57BL/6N mouse lines were purchased from Charles River. The AAV vector expressing Cepheid1b-ST ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2020) were generated as previously described and compared to age and sex matched wild-type C57Bl/6 controls (Charles River, UK or Vital-River, China). Endothelial-specific cyclo-oxygenase-1 knockout mice (Ptgs1flox/flox ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Experiments and procedures on non-human primates were performed as fee-for-service by Charles River Laboratories with approval of Charles River’s Institutional Animal Care and Use Committee (IACUC) ...
-
bioRxiv - Neuroscience 2021Quote: Mouse studies: CD1 mice (gestation day 12.5; Charles River Laboratories) were housed (12 h dark/light cycle and less than 5 mice per cage ...
-
bioRxiv - Cancer Biology 2020Quote: ... C57Bl6 and immunocompromised mouse lines were purchased from Charles River.
-
bioRxiv - Immunology 2021Quote: ... Bone marrow cells were tested for mouse pathogens (Charles River) prior to use.
-
bioRxiv - Physiology 2022Quote: ... Mouse lines used in this study were: CD1 (Charles River), MafB-Cre (Wu et al. ...
-
bioRxiv - Developmental Biology 2023Quote: Mouse lines: CD-1 mice were obtained from Charles River Laboratories ...
-
bioRxiv - Cancer Biology 2020Quote: ... to each male SCID/Beige mouse (8-week old; Charles River), 100 μL of 2.5 × 106 cells/mL in DPBS was intracardially injected ...
-
bioRxiv - Cancer Biology 2020Quote: ... To each male SCID/Beige mouse (7-week old; Charles River), 100 μL of 1 × 107 cells/mL in DPBS was intracardially injected into the left cardiac ventricle ...
-
bioRxiv - Cancer Biology 2020Quote: ... For each male SCID/Beige mouse (7-week old; Charles River), 100 μL mixture was subcutaneously injected into both flanks ...
-
bioRxiv - Microbiology 2021Quote: ... three- to five-day-old mouse neonates (Charles River, Wilmington, MA) were orogastrically infected with approximately 106 bacterial cells following 2 hours of separation from dam mice and maintained at 30°C for 20h ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A Male Balb/C mouse weighing 25 g (Charles River, UK), allowed free access to standard rodent chow and water ...
-
bioRxiv - Microbiology 2019Quote: ... Bacteria were opsonized with 10% BALB/c mouse serum (Charles River) in 10 volumes of DMEM for 30 min on ice ...
-
bioRxiv - Microbiology 2022Quote: ... bacteria were opsonised with 10% BALB/c mouse serum (Charles River) in 10 volumes of DMEM for 30 min on ice.
-
bioRxiv - Cancer Biology 2023Quote: ... For each male SCID/Beige mouse (7-weeks-old; Charles River #CRL:250 ...
-
bioRxiv - Neuroscience 2024Quote: ... we used the following mouse lines: CD1 (ICR) (Charles River: 022) and Ai14 (Jackson Labs ...
-
bioRxiv - Immunology 2022Quote: Non-human primate (NHP) studies were conducted at Charles River Laboratories (Shrewsbury, MA) and approved by Charles River-MA Institutional Animal Care and Use Committee (IACUC ...
-
bioRxiv - Cell Biology 2023Quote: CD4+ and CD8+ cells were positively selected from a de-identified healthy human donor apheresis (Charles River Laboratories) using anti-CD4 and anti-CD8 microbeads (Miltenyi ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Experiments were performed on outbred strain CD1 mouse pups (Charles River Laboratories). Analyses are thought to include animals of both sexes at approximately equal proportions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mouse experiments: 6-8 weeks-old female BalB/c mice (Charles River) were used in all experiments ...
-
bioRxiv - Neuroscience 2021Quote: The C57BL/6J mouse line was used as background strain (Charles River). Mice expressing Cre from the Pitx3 locus and Cre induced YFP from the Rosa26 were previously described (35 ...
-
bioRxiv - Neuroscience 2022Quote: Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17 ...
-
bioRxiv - Neuroscience 2022Quote: Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17 ...
-
bioRxiv - Immunology 2023Quote: ... B6.SJL-PtprcaPepcb/BoyCrl (CD45.1) mouse stain was obtained from Charles River Laboratory ...
-
bioRxiv - Neuroscience 2023Quote: Primary DRGs were cultured from E13.5 CD1 mouse embryos (Charles River Laboratories). DRGs were dissected in DMEM ...
-
bioRxiv - Cell Biology 2024Quote: The mouse strains used in this study were purchased from Charles River Laboratories (ICR mice ...
-
bioRxiv - Neuroscience 2020Quote: ... Embryos (aged E12.5 - E16.5) of the mouse strain ICR (CD1, Charles River Laboratory) were used for in utero experiments and primary culture ...
-
bioRxiv - Neuroscience 2019Quote: Hippocampal neuronal cultures were prepared from C57BL/6J mouse embryos (Charles River Laboratories). UPF2-shRNA 1 virus is on a piLenti-shRNA-GFP backbone carrying one shRNA against the UPF2 mRNA (AGGCGTATTCTGCACTCTAAAGGCGAGCT) ...
-
bioRxiv - Neuroscience 2020Quote: ... Hippocampi were isolated from postnatal day 0 (P0) CD-1 mouse (Charles River) brain tissues and digested with 10U/mL papain (Worthington Biochemical Corp ...
-
bioRxiv - Neuroscience 2021Quote: ... DRG was dissected from embryonic days 13.5-14.5 CD1 mouse (Charles River Laboratories) and incubated with 0.05% Trypsin solution at 37 °C for 20 minutes ...
-
bioRxiv - Physiology 2024Quote: The following mouse strains were used in this study: C57BL/6 (Charles River), Sirt2flox 57 ...
-
bioRxiv - Physiology 2022Quote: ... Mice expressing the cre recombinase under the control of the human cytomegalovirus minimal promoter (CMV-cre+/-) were purchased from Charles River Laboratories (Sulzfeld ...
-
bioRxiv - Developmental Biology 2022Quote: ... was used to identify potential binding partners for multimerised human CACHD1 ectodomain (prepared as above) and was performed by Charles River Discovery Research Services UK Limited (formerly Retrogenix Limited ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The effects of PF-07304814 and PF-00835231 on human red blood cell hemolysis and plasma flocculation were evaluated in GLP-compliant studies conducted by Charles River Laboratories on behalf of Pfizer Inc ...
-
bioRxiv - Immunology 2023Quote: ... Nephrectomies were performed on 12 human C5aR knock-in male mice aged 7-10 weeks by a surgeon contracted from Charles River Laboratories ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary mouse myoblasts (mskMPs) from 3-week-old C57Bl6/J (Charles River, C57BL/6NCrl) mice were maintained in collagen I coated dishes (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... All mouse lines were in the C57BL/6J background (>10 generations, Charles River, USA), besides Scn1a+/− mice that were in a mixed background (C57BL/6J-CD1 85:15%).
-
bioRxiv - Neuroscience 2021Quote: ... Biological specimens for imaging were obtained from a C57Bl6 mouse (Charles River Labs, UK) expressing mCherry sparsely in neurons of the Lateral Posterior nucleus (LP ...