Labshake search
Citations for Promega :
201 - 250 of 5352 citations for rno mir 22 Real Time RT PCR Detection and U6 Calibration Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... RT-PCR was performed with the GoTaq® Green Master Mix as per manufacturer’s instructions (Promega, USA). For RIP analysis ...
-
bioRxiv - Biochemistry 2021Quote: Purified RT-PCR products were cloned in to pGEM vector using pGEM- T easy vector Systems (Promega) as described by manufacturer and transformed into heat- competent 10-Beta cells (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... GDP detection kit was from ProFoldin (MA, USA) and ADP-Glo™ Kinase Assay kit from Promega Corporation ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCR products were purified using a Wizard PCR clean-up kit (Promega) before sequencing (Eurofins Genomics).
-
bioRxiv - Genomics 2023Quote: ... We added 200 µL of PBS to each cell pool and performed the 22 DNA extractions using the Buccal Swab protocol of the ReliaPrep™ gDNA Tissue Miniprep System kit (Promega). We adjusted the lysis time to two hours before performing the RNAse treatment ...
-
bioRxiv - Cell Biology 2020Quote: IC50 was determined on days 3 and 4 after vemurafenib treatment using Real-time-Glo MT Cell Viability Assay according to the manufacturer’s protocol (Promega, #G9711). Using a 96-well white plate ...
-
bioRxiv - Cell Biology 2021Quote: ... and luciferase assay performed using a dual luciferase chemiluminescence detection kit (Promega #E1910) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: BMDMs cell death was determined using LDH Cytotoxicity Detection Kit (Promega, Cat#G1780). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Genomics 2022Quote: ... and cDNA synthesis using the GoScript RT Kit and oligo dT primer (Promega). To amplify the random 5’ and 3’ BC from the plasmid DNA or cDNA sample ...
-
bioRxiv - Genomics 2019Quote: ... PCR for the detection of Y-linkage was performed with GoTaq® Hot Start Polymerase (Promega, cat# M5005) and primers were designed to target exons (for gene Y-linkage tests ...
-
bioRxiv - Immunology 2021Quote: ... qRT-PCR was performed in 12 μL reactions using GoTaq Probe 1-step RT-qPCR System (Promega, US) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... using either miR-430/5S rRNA specific reverse primers or random hexamers (Promega, C118A) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PCR products were cleaned up using PCR clean up kit (# A9282, Promega). sgRNAs were synthesized using the MEGAShortScript™ Kit (# AM1354 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Both PCR products were purified using the Wizard PCR cleanup kit (Promega, USA).
-
bioRxiv - Zoology 2021Quote: ... PCR products were purified with Wizard SV Gel and PCR Cleanup kit (Promega). Purified products were sequenced at Sequetech DNA Sequence Service (Mountain View ...
-
bioRxiv - Molecular Biology 2023Quote: ... Detection System (Promega) using the Fluorometer Blue module ...
-
bioRxiv - Cancer Biology 2023Quote: The assessment of gene expression was performed by quantitative real-time Polymerase Chain Reaction (qPCR) using the GoTaq® qPCR Mix (Promega) in the 7500 Fast Real Timer PCR system (Applied Biosystems®) ...
-
bioRxiv - Systems Biology 2022Quote: ... AMV RT (Promega) with 9 bp random primers was used for reverse transcription ...
-
bioRxiv - Microbiology 2023Quote: ... AMV-RT (Promega) was used to reverse-transcribe the RNA-protein complex reaction at 30 °C for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... The calibration curves were generated using serial dilutions of pGEM-T Easy plasmid DNA (Promega, USA) carrying a single copy of the target gene fragment (qp1F/qp1R) ...
-
bioRxiv - Cell Biology 2020Quote: ... and PPIs were analyzed with NanoBRET™ Nano-Glo® Detection System kit (Promega) following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... for the detection of relative light units using the Firefly Luciferase Assay Kit (Promega) with an Ultra 384 luminometer (Tecan) ...
-
bioRxiv - Microbiology 2022Quote: ... for the detection of relative light units using the Firefly Luciferase Assay Kit (Promega) on the instrument of an Ultra luminometer (Tecan) ...
-
bioRxiv - Synthetic Biology 2023Quote: Detection of the cAMP was performed using a commercial luciferase-based kit (#V1501, Promega) in 384-well format using cell lysates according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and TCID50 equivalents determined using a SARS-CoV-2 E gene detection kit (Promega) based upon the Berlin primer/ probe set (70).
-
bioRxiv - Biochemistry 2023Quote: ... The measurements used the Enliten ATP Assay System (Bioluminescence Detection Kit, Promega, Madison, WI). The luminescence reaction contained 5 µL of neutralized acid-soluble supernatant and 45 µL of luciferin/luciferase reagent ...
-
bioRxiv - Cell Biology 2023Quote: ... Nanoluciferase activity was assessed using the Nano-Glo In-Gel Detection kit (Promega, USA) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and the 200 nM GoTaq® Probe 1-Step RT-qPCR System Kit (Promega). This kit uses GoTaq Probe qPCR Master Mix with dUTP (10 uL) ...
-
bioRxiv - Physiology 2021Quote: ... RT was carried out using M-MLV RT enzyme (Promega #M1705) to obtain cDNA ...
-
bioRxiv - Microbiology 2019Quote: ... The RT-PCR fragments corresponding to the LP region were also cloned into a pGem-T easy vector (Promega) and Sanger sequenced.
-
bioRxiv - Molecular Biology 2024Quote: ... RT-PCR was used to amplify the OGDH 3’UTR and sub clone it into pmirGLO vector (Promega, UK). 5 × 10^4 C2C12 cells were seeded into 12 well plates ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the PCR Promega kit (Promega Corporation, WI, États-Unis) following the manufacturer’s instructions and sent to Genewiz company (www.genewiz.com/en-GB ...
-
bioRxiv - Microbiology 2021Quote: ... followed by a reverse transcriptase (RT)-step with Moloney Murine Leukemia Virus RT (MMLV-RT, Promega, Madison, WI, USA) in the presence of RNase inhibitor (RNAsin plus ...
-
bioRxiv - Immunology 2023Quote: ... Promega GoTaq qRT-PCR kit (Promega, Fitchburg USA) was used according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... then analyzed for ATP levels using the ENLITEN ATP Assay System Bioluminescence Detection Kit (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2020Quote: Cellular viability was measured by bioluminescent detection of ATP (CellTitre-Glo® assay kit (Promega)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and firefly and Renilla luciferase activities were measured using the Dual-Luciferase detection kit (Promega) with a bioluminescence plate reader (Citation ...
-
bioRxiv - Physiology 2021Quote: ... The fluorescence activity was determined using a fluorescence activity detection kit (Promega, Madison, WI, USA).
-
bioRxiv - Neuroscience 2023Quote: The assay was performed using a Luminescent ATP detection assay kit from Promega (Wisconsin, USA). 50 µL of isolated mitochondria (LDM ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR products were cleaned with the Wizard SV Gel and PCR Clean Up Kit (Promega) and cut with XhoI and BamHI or HindIII und BamHI (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2021Quote: ... Input linear DNA was produced by PCR and cleaned with PCR cleanup kit (Promega, A6754), quantified and diluted to desired concentrations using ultra-pure water ...
-
bioRxiv - Immunology 2024Quote: The PCR products representing genomic and cDNA sequences were purified using PCR purification kit (Promega) and subsequently sequenced using Sanger sequencing at Micromon Genomics ...
-
bioRxiv - Bioengineering 2021Quote: ... Ligations of the digested plasmid backbones and PCR products occurred for 5-10 minutes at RT using T4 DNA ligase (Promega) prior to transformation into NEB® Turbo Competent E ...
-
bioRxiv - Physiology 2019Quote: The expression profile of PKC isoforms in UMR106 cells was studied by RT-PCR using the GoTaq Green Master Mix (Promega) and the primers listed in Table 1 ...
-
bioRxiv - Plant Biology 2019Quote: Semi-quantitative RT-PCR was performed on RNA isolated of 10 days-old seedlings using the total RNA isolation system (Promega). Reverse transcription was performed on 300 ng of total RNA using the iScript advanced kit (BioRad) ...
-
bioRxiv - Bioengineering 2019Quote: ... a specific BYDV nucleotide sequence (294 bp, primers PVinterF+YanRA) amplified by RT-PCR was inserted into the vector pGem-T Easy (Promega) and cloned into E ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... QRT-PCR reactions were performed by using the GoTaq®1-Step RT-qPCR System (Promega Scientific, Madison, WI, USA) with Bio-Rad CFX Connect (Bio-Rad Laboratories ...
-
bioRxiv - Developmental Biology 2020Quote: ... Each quantitative RT-qPCR reaction was performed using the GoTaq qPCR Master Mix kit (Promega). For a 10 μl reaction ...
-
bioRxiv - Cancer Biology 2019Quote: ... which were performed with the use of GoScript RT kit following the manufacturer’s instructions (Promega).