Labshake search
Citations for Promega :
401 - 450 of 2349 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and M-MLV RT RNAse (H-) Point Mutant (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... we used 5 μL of 5X RT buffer (Promega), 5 μL of dNTPs ...
-
bioRxiv - Molecular Biology 2021Quote: ... the GoTaq® 1-Step RT-qPCR System (Promega) was used with the primers (F ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were equilibrated to RT and CellTiter-Glo (Promega) solution (100μL ...
-
bioRxiv - Biochemistry 2021Quote: ... and GoTaq® 1-Step RT-qPCR System (Promega) were used for RT-qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBR Green GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μg total RNA and 0.5 μg random primers (Promega) were used with the GoScript™ Reverse transcriptase (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μg total RNA and 0.5 μg random primers (Promega) were used with the GoScript Reverse transcriptase (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μg total RNA and 0.5 μg random primers (Promega) were used with the GoScript™ Reverse transcriptase (Promega ...
-
bioRxiv - Immunology 2021Quote: ... RNA was reverse transcribed using oligo(dT) primers (Promega, C1101), M-MLV (Promega ...
-
bioRxiv - Molecular Biology 2019Quote: ... and RNA was reverse transcribed with Random Primers (Promega C1181) and MMLV Reverse Transcriptase (Sigma M1302 ...
-
bioRxiv - Physiology 2019Quote: ... and a mix of oligo dT and random primers (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... in the presence of oligo(dT)15 Primer (Promega, #C1101), dNTPs (Euroclone) ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by primer extension with 2U AMV reverse transcriptase (Promega) in supplied buffer containing 1 mM ddNTP ...
-
bioRxiv - Microbiology 2020Quote: ... 1 µg total RNA and 0.5 μg random primers (Promega) were used with the GoScript™ Reverse transcriptase (Promega ...
-
bioRxiv - Developmental Biology 2022Quote: ... Each reaction mixture (20 µL) also included hexadeoxynucleotide primers (Promega), dNTPs and RNasin (Promega) ...
-
bioRxiv - Molecular Biology 2023Quote: ... primer extension reactions were done using AMV reverse transcriptase (Promega) and 32P-labeled primer (Pisarev et al. ...
-
bioRxiv - Physiology 2023Quote: ... and oligo(dT)15 primers (Promega, C110A, Madison, WI, USA). Quantitative real-time RT-PCR was performed in a Rotor-Gene Q (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µg total RNA and 0.5 μg random primers (Promega) were used with the GoScript™ Reverse transcriptase (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... the presence of other main circulating arboviruses was evaluated by RT-qPCR using GoTaq® 1-Step RT-qPCR System (Promega, Madison, WI, USA). Specific diagnosis primers were used for Zika [30] ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription (RT) was performed with AMV reverse transcriptase (Promega) in final volume 20 μl for 1h at 42°C on 1 μg of total RNA in the presence of two reverse primers (1 μl of 5 μM solution each ...
-
bioRxiv - Neuroscience 2020Quote: ... using the GoTaq® 2-step RT-qPCR kit (Promega). Quantitative PCR runs were performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... and then cDNA was produced using M-MLV RT (Promega) and random hexamers ...
-
bioRxiv - Neuroscience 2022Quote: ... using GoTaq® Probe 1-Step RT-qPCR System (Promega). The CDC SARS-CoV-2 nucleoprotein N2 primer set was used for amplification ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using GoTaq qPCR Master Mix (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1 μL of reverse transcriptase (M-MLV RT, Promega) and incubated the samples for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... using the GoTaq 1-Step RT-qPCR System (Promega, USA) and primers targeting the gene coding for the endogenous control β-actin ...
-
bioRxiv - Molecular Biology 2020Quote: ... RT-qPCR was performed using GoTaq qPCR Master mix (Promega). Cycling conditions were as follows ...
-
bioRxiv - Immunology 2020Quote: ... using the MMLV-RT reverse transcriptase enzyme (Promega, Madison WI) to obtain the complementary DNA (cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 mM dNTP) and 1 μl of AMV RT (Promega) was added and the sample was incubated at 42 °C for 1 hour ...
-
bioRxiv - Physiology 2020Quote: ... Reverse transcription (RT) was performed with AMV-reverse transcriptase (Promega). Quantitative PCR (qPCR ...
-
bioRxiv - Biophysics 2023Quote: ... Reverse transcription was performed with M-MLV RT (Promega, USA) according to the manufacturer protocol with the primer Pow-TBE-3’ ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA digestion was performed using the RQ1 RNase-free DNase set (Cat No.: M6101, Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: Total RNA was reverse transcribed to cDNA using random primers (Promega) and M-MLV Reverse Transcriptase RNase H (Promega) ...
-
bioRxiv - Neuroscience 2021Quote: ... and reverse transcribed with GoScript Reverse Transcriptase with random primers (Promega). Real-time quantitative PCR was done using FAM-MGB-labeled Col6a3 (Mm00711678_m1 ...
-
bioRxiv - Plant Biology 2020Quote: ... using M-MLV reverse transcriptase and oligo(dT)15 primer (Promega). Two ng of cDNA was used as template in qPCRs ...
-
bioRxiv - Bioengineering 2020Quote: ... with specific primers (Suppl. Table 1) from pNL1.1 (Promega, Fitchburg, WI) and inserted between the SalI and BglII sites using NEBuilder HiFi DNA Assembly Master Mix ...
-
bioRxiv - Immunology 2019Quote: ... with the addition of 150 ng random primers (Promega, Madison, WI). Cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was transcribed into cDNA using an oligo dTn primer (Promega) per reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was transcribed into cDNA using an oligo dTn primer (Promega) per reaction ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... an anchor-oligo(dT) primer (Table S1) and random hexamers (Promega). The reverse anchor and forward nested degenerated PGM primers derived from the oyster Crassostrea gigas and human Pgm-1 sequences were then used to perform the upstream amplification of cDNA fragments (see Table S1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of 100 ng/µL random hexamer primers (Promega: C1181) was added to each sample ...
-
bioRxiv - Immunology 2023Quote: ... 100 nM probe and 150 ng random primers (Promega, Madison, WI). Reactions cycled with the following conditions ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 nM dT-primer and 4 U RNase Inhibitor (Promega, N2611). Reverse transcription was performed at 42°C for 90 min after filling up to 10 μl with RT buffer mix for a final concentration of 1x superscript II buffer (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA (500 ng) was reverse transcribed using random primers (Promega) and AMV Reverse Transcriptase (Promega ...
-
bioRxiv - Plant Biology 2023Quote: ... oligo(dT) primer and reverse transcriptase ImProm-II (Promega, https://www.promega.com). Three biological replicates for each type of sample were used for sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... oligo(dT) 18 primers and the GoScript™ Reverse Transcriptase (Promega). qRT-PCR was performed using gene-specific primers (Supplementary Table 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the RNasin Plus RNase inhibitor and random primers (all from Promega). SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10X Primer extension buffer and 2 U AMV Reverse Transcriptase (Promega) were added to the annealing mixture and incubated for 1 hour at 42 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... according to the instructions: stock oligo(dT)15 primer (C1101, Promega) concentration was 100 ng/μl ...