Labshake search
Citations for Promega :
51 - 100 of 1355 citations for Upstream stimulatory factor 2 USF2 Antibody HRP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... miR153 Upstream Seq HindIII R: TATATAAAGCTTCTAAGTAGCTGGCAAAGT) of promoter-less pGL4.10 Firefly luciferase construct (Promega), and the NFAT binding site mutated via site directed mutagenesis (miR153 NFAT Mut F ...
-
bioRxiv - Molecular Biology 2019Quote: ... incubated with anti-mouse or anti-rabbit HRP-conjugated secondary antibody for 30min (anti-mouse IgG HRP conjugate Promega #W402B ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary antibodies were 1:5,000 HRP-conjugated anti-rabbit (W4011; Promega) or mouse (W4021 ...
-
bioRxiv - Biochemistry 2019Quote: ... and HRP-conjugated rabbit anti-mouse antibody 1:10,000 (Promega, W4028). The plate was developed with 2,2’-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid ...
-
bioRxiv - Plant Biology 2021Quote: ... Blots were developed with horseradish peroxidase (HRP)-linked secondary antibodies (Promega) and Immobilon Western Chemiluminescent HRP Substrate (Merck).
-
bioRxiv - Molecular Biology 2022Quote: ... Washes and incubation of HRP-conjugated secondary antibodies (1:5000, Promega) were performed in PBST (0.05% Tween 20 in PBS) ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by incubation with their respective HRP-conjugated secondary antibodies (Promega). The membrane was soaked with Chemi-Lumi Super (Nakarai Tesque ...
-
bioRxiv - Microbiology 2022Quote: ... and an anti-mouse IgG HRP conjugate secondary antibody (Promega, #W4021) (13) ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were then incubated with an HRP-conjugated secondary antibody (Promega) for one hour ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by the anti-rabbit HRP-conjugated secondary antibody (#W4011; Promega).
-
bioRxiv - Immunology 2023Quote: ... All secondary HRP-conjugated antibodies were obtained from Promega (Madison, WI). For immunofluorescence only ...
-
bioRxiv - Plant Biology 2024Quote: ... and HRP-conjugated secondary antibody (Promega, Cat# W4011, 1:4,000 dilution).
-
bioRxiv - Molecular Biology 2020Quote: ... upstream of a luciferase reporter molecule in the context of a pGL3 plasmid (Promega, E1751). Plasmids designed for whole zebrafish injection were generated by replacing the firefly luciferase reporter with an enhanced green fluorescent protein (eGFP ...
-
bioRxiv - Cell Biology 2021Quote: The HSV-TK promoter was cloned upstream of luciferase in the pGL4.10[luc2] plasmid (Promega). A 122 bp region of the E2f7 promoter or a 2.1kb region of the E2f8 enhancer was cloned into the XhoI site upstream of the HSV-TK promoter ...
-
bioRxiv - Immunology 2023Quote: ... was inserted upstream of the luc2 gene in the pGL4.10[luc2] plasmid (Promega Cat. E6651). As the SNP was located within the promoter region ...
-
bioRxiv - Immunology 2023Quote: ... was inserted upstream of the luc2 gene in the pGL4.10[luc2] plasmid (Promega Cat. E6651). Following this step ...
-
bioRxiv - Microbiology 2020Quote: ... Secondary HRP conjugated goat anti-mouse IgG antibodies (Promega, Madison, WI; W4021) was used at 1:50,000.
-
bioRxiv - Microbiology 2023Quote: ... followed by horseradish peroxidase-conjugated (HRP) secondary rabbit antibodies (Promega, 1/25000) and revealed by chemiluminescence (Pierce ...
-
bioRxiv - Biochemistry 2023Quote: ... Secondary antibodies used were: anti-rabbit-IgG-HRP (W401B, 1:8000, Promega); anti-mouse-IgG-HRP (W402B ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by HRP-conjugated secondary anti-mouse antibody (1:5000, Promega W402B), diluted as indicated ...
-
bioRxiv - Biophysics 2020Quote: ... antibodies followed by a 1-hour incubation with the corresponding HRP-conjugated secondary antibodies (1:2000, Promega) at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: The upstream region of myogenin (−1650/+51) was PCR-amplified and clonedinto the pGL4.20 vector (Promega). The hnRNPK-expressing plasmid was a kind gift from Dr ...
-
bioRxiv - Molecular Biology 2021Quote: ... secondary antibody staining was performed for 1 h at room temperature using anti-rabbit HRP or anti-mouse HRP secondary antibodies (Promega, 1:10,000) in blocking buffer ...
-
bioRxiv - Microbiology 2020Quote: ... As secondary antibody an anti-mouse IgG HRP conjugate (Promega, Madison, WI, USA) was used ...
-
bioRxiv - Microbiology 2019Quote: ... Secondary antibodies (anti-mouse or anti-rabbit) conjugated to horseradish peroxidase (HRP, Promega) were diluted 1:25,000 in 3% (w/v ...
-
bioRxiv - Immunology 2020Quote: ... 1:3,000 dilution of HRP-conjugated anti-mouse IgG secondary antibody (W402B, Promega) was added and incubated for one additional hour ...
-
bioRxiv - Microbiology 2022Quote: ... followed by a horseradish peroxidase (HRP)-conjugated anti-rabbit IgG secondary antibody (Promega). Chemiluminescence signals were detected using the GE ImageQuant LAS4000 camera (GE Healthcare Life Sciences).
-
bioRxiv - Genomics 2022Quote: ... followed by incubation with horsradish peroxidase (HRP)-conjugated secondary antibodies (Promega, Madison, WI). The chemiluminescence signals were detected using a Western blot developing machine (Fusion Solo S chemiluminescence imager ...
-
bioRxiv - Microbiology 2022Quote: ... Secondary anti-mouse IgG HRP antibody was used at 1:7000 dilution (Promega). ChemiDoc (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... from Invitrogen and HRP-conjugated anti-mouse (W4021) and anti-rabbit (W4011) antibodies from Promega.
-
bioRxiv - Plant Biology 2023Quote: ... incubated with the secondary antibody rabbit anti chicken IgY HRP [(Promega Corporation, G1351) 1:10000] for 2 h and again washed three times ...
-
bioRxiv - Genomics 2024Quote: ... Membranes were then incubated with 1:10000 HRP-conjugated secondary antibody (Promega #W402B) in TBST + 5% milk for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... was inserted upstream of the hTERT sequence by enzymatic digestion (XbaI and MluI, Promega AG, Dübendorf, CH) and subsequent ligation (Rapid DNA Ligation Kit ...
-
bioRxiv - Biochemistry 2021Quote: ... we introduced an EcoRI restriction site upstream of hRLuc-neo fusion sequence in pmirGLO vector (Promega®) using Quick Change site-directed mutagenesis kit II XL (Thermo Fischer Scientific®) ...
-
bioRxiv - Genetics 2024Quote: ... were cloned upstream of a minimal promoter driven firefly luciferase reporter gene in the pGL4.23 vector (Promega). Existing plasmids constructs of variant-centered test elements for the five variants of interest (see Dataset S1 for genomic regions ...
-
bioRxiv - Microbiology 2019Quote: ... used at a 1:10,000 dilution and the secondary antibody was an Anti-Mouse IgG HRP conjugate antibody (Promega) also used at a 1:10,000 dilution.
-
bioRxiv - Genetics 2022Quote: ... membranes were washed and incubated with the appropriate HRP conjugated secondary antibody (1:3,000 anti-rabbit W401B antibody from Promega), and the reaction was finally visualized with the Western Blotting Luminol Reagent (Santa Cruz Biotechnology) ...
-
bioRxiv - Plant Biology 2019Quote: ... The secondary antibody was an anti-mouse coupled to HRP 1:10,000 (W4021, Promega). Detection was performed with the Pico Plus system (34580 ...
-
bioRxiv - Cell Biology 2019Quote: ... As secondary antibody a mouse IgG HRP conjugate was used (Promega, Madison, WI, USA). Detection was carried out by using AceGlow (VWR Peqlab ...
-
bioRxiv - Biochemistry 2020Quote: ... and goat anti-rabbit IgG (H+L) antibody conjugated to HRP (Promega, catalog # W4018). Immunoblots were imaged using iBright 1500 (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... HRP conjugated anti-rabbit (W401B) and anti-mouse (W402B) secondary antibodies were from Promega. CB-5083 was a gift from Cleave Biosciences and Bortezomib was from Selleckchem ...
-
bioRxiv - Microbiology 2021Quote: ... The secondary antibody is anti-guinea pig IgG conjugated to horseradish peroxidase (HRP) (Promega). ImageQuant LAS4000 camera (GE Healthcare Life Sciences ...
-
bioRxiv - Microbiology 2021Quote: ... Anti-mouse and anti-rabbit HRP-conjugated secondary antibodies were purchased from Promega (USA). Alexa Fluor 488 and Alexa Fluor 594 antibodies were purchased from Invitrogen (USA) ...
-
bioRxiv - Neuroscience 2020Quote: ... overnight at 4°C and HRP-conjugated anti-rabbit antibody (1:2,000, W4011, Promega) for 1 hr at room temperature followed by ECL signal amplification and chemiluminescence detection (SuperSignal West Pico Chemiluminescent Substrate ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-mouse (W4028) and anti-rabbit (W4018) HRP conjugated secondary antibodies were from Promega. Anti-mouse Alexa® Fluor 488 (#A32790 ...
-
bioRxiv - Immunology 2021Quote: ... adding rabbit anti-chicken IgY which HRP-conjugated secondary antibodies (Promega, Madison, WI, USA) in the dilution of 1:5000 and incubated at 37°C for an hour ...
-
bioRxiv - Neuroscience 2023Quote: ... Secondary antibodies used for western blot include anti-Rabbit-HRP (1:20000, Promega W4011); anti-Mouse-HRP (1:20000 ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by the secondary anti-rabbit HRP-conjugated antibody (W401B, Promega, Madison, Wi, USA), diluted 1:10.000 in 5% BSA TBS-T ...
-
bioRxiv - Cell Biology 2020Quote: ... CBS1 and CBS2 of CCAT1 and E2F1-CBS upstream of E2F1 were amplified from HCT116 genome and inserted into pGL4.27 and pGL4.11 (Promega) in the sense orientation relative to the luciferase coding sequence ...
-
bioRxiv - Cancer Biology 2021Quote: The upstream 376 bp region of the human LGALS1 transcriptional start site was cloned into the pGL4.23 (Promega) vector to generate the LGALS1 luciferase reporter gene (LGALS1 pGL4.23 ...