Labshake search
Citations for Promega :
51 - 100 of 1025 citations for Tumor necrosis factor receptor superfamily member 3 TNFRSF3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Plasmid DNAs were transfected into HEK293 cells with ViaFect Transfection Reagent (Promega) according to manufacturer’s instruction.
-
bioRxiv - Physiology 2023Quote: ... whereas HEK293 cells stably expressing a luminescent cAMP GloSensor (GS-293) (Promega) were previously created in our lab 25 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tumor progression was monitored by weekly intraperitoneal injections of luciferin (Promega) and bioluminescence imaging (BLI ...
-
bioRxiv - Microbiology 2023Quote: ... or the Magne-His purification system (Promega Corporation) for PlzARD-RD per manufacturer protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... were cloned into pcDNA3.1-myc-His plasmid (Promega). For sequencing we used a sequence analyser (ABI Prism 3100 Avant ...
-
bioRxiv - Physiology 2023Quote: ... 25 ng/mL fibroblast growth factor (bFGF; Promega), 1% penicillin streptomycin ...
-
bioRxiv - Neuroscience 2019Quote: ... HEK293 cells were transfected in the 24 well plates using Fugene HD (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Retrovirus was produced through transfection of HEK293 cells using FuGENE 6 (Promega, E2692). Two days after transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... 25,000 HEK293-T cells were seeded and transfected with FuGENE 6 (#E231A, Promega) and plasmid DNA at the carrier (µL):DNA (µg ...
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Cancer Biology 2023Quote: ... paraffin-embedded xenograft tumor tissue sections using DeadEnd Colorimetric TUNEL System (Promega) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2019Quote: ... genomic DNA from puromycin selected cells and wild-type HEK293 cells was extracted (Promega Wizard Genomic DNA Purification Kit #A1120 ...
-
bioRxiv - Neuroscience 2022Quote: HEK293 cells (ATCC, Manassas, VA) stably expressing both D3R and GloSensor 22F-cAMP (Promega) were created for these experiments ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... HEK293 cells were transfected with the VHL-NanoLuc fusion constructs using FuGENE HD (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293-µOR cells were transfected with a plasmid encoding pGloSensor-20F cAMP reporter (Promega). Cells were harvested 24 h post transfection and resuspended at a 1.5x10^6 live cells/ml in assay media (DMEM without phenol red or FluoroBrite DMEM ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Biophysics 2022Quote: ... Factor Xa protease (SKU PR-V5581, Promega, Madison, WI) was used to cleave MBP-Q44-HttEx1 at 22 °C (Boatz et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transfected with 1.5 μg receptor and 1 μg GloSensor-22F (Promega). After 24 hours ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 cells were treated for 8 hours with either 0.1 µmoles/L Coumermycin A1 (Promega) or an equivalent volume of DMSO ...
-
bioRxiv - Microbiology 2022Quote: ... HEK293 cells were transfected using FuGeneHD transfection reagent according to manufacturer’s protocol (Promega, Cat # E2311). 48 hours post-transfection ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293 cells were transfected using FuGeneHD transfection reagent according to manufacturer’s protocol (Promega, Cat # E2311). 48 hours post-transfection ...
-
bioRxiv - Biochemistry 2019Quote: HEK293 was used for transfection of plasmids with FuGENE HD Transfection reagent (Promega, Tokyo, Japan). RIPA buffer was used for obtaining proteins from whole cells ...
-
bioRxiv - Immunology 2020Quote: ... expression constructs were transfected into the HEK293 EBNA cells using FuGENE HD transfection reagent (Promega). After selection with puromycin ...
-
bioRxiv - Neuroscience 2023Quote: Plasmid constructs were acutely transfected into HEK293 cells using Viafect reagent (E4981; Promega, Madison, WI), following the manufacture’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... the His-VqmA was purified using MagneHis Ni-Particles (Promega).
-
bioRxiv - Molecular Biology 2022Quote: ... His-tagged proteins were purified using Ni-NTA resin (Promega); bound proteins were washed with binding buffer and eluted into elution buffer (4 M urea ...
-
bioRxiv - Cell Biology 2024Quote: ... HIS-PLK1 used in ADP-Glo was from Promega (V2841). HIS-PLK1 used in Fig ...
-
bioRxiv - Cancer Biology 2023Quote: ... murine epidermal growth factor (20 ng/ml; Promega, Madison, WI), and heparin (50 µg/ml ...
-
bioRxiv - Cancer Biology 2021Quote: ... Viability of tumor organoids was assessed by CellTiter-Glo® 2.0 assay (Promega, #G9242) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Equal quantities of tumor genomic DNA were amplified by PCR with GoTaq (M7123, Promega) using the gene-specific primers listed ...
-
bioRxiv - Neuroscience 2024Quote: The short TMEM106B 3’ UTR and the long TMEM106B 3’ UTR were amplified from human genomic DNA (H1) and then cloned into the pmirGLO Dual-Luciferase Vector (Promega, E1330) using Gibson assembly ...
-
bioRxiv - Cancer Biology 2019Quote: ... HEK293 or MIA PaCa-2 cells were transfected with different AGO2 constructs using Fugene HD (Promega) or Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified BAC and plasmid DNA were transfected into HEK293 cells with FuGene HD transfection reagent (Promega) in a 1:3 DNA:FuGene HD ratio ...
-
bioRxiv - Cell Biology 2023Quote: HEK293 cells were transfected with β1AR and a cyclic-permuted luciferase reporter construct (pGloSensor-20F, Promega) and luminescence values were measured ...
-
bioRxiv - Synthetic Biology 2023Quote: ... His-tag proteins have been purified by using MagneHis system (Promega) and DynaMag spin magnet (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... Ca2+-dependent nuclear factor of activated T-cells (NFAT) (pGL4.30; Promega), or the MAPK signaling pathway (pGL4.33 ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was extracted from FFPE tumor tissue using the Maxwell RSC DNA FFPE Kit (Promega) or the GeneRead DNA FFPE kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-untranslated region (3’-UTR) fragment of IκBα (human/rat) was inserted into the pGL3-basic vector (firefly luciferase; Promega, Madison, WI, USA), which was obtained from General Biosystems (Anhui ...
-
bioRxiv - Immunology 2021Quote: ... Luciferase activity in infected hACE2-HEK293 cells was measured with a Bright-Glo Luciferase assay system (Promega) and a Beckman Coulter DTX880 plate reader ...
-
bioRxiv - Biophysics 2020Quote: ... Changes in the intracellular cAMP concentration of the HEK293 cells were measured by the GloSensor assay (Promega). The transfected cells were incubated with or without 0.5 μM all-trans-retinal (Toronto Research Chemicals) ...
-
bioRxiv - Biophysics 2021Quote: ... Constructs (2 μg) were transfected into HEK293 cells on glass coverslips using Fugene HD (Promega, Madison, WI) per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK293 cells were washed with 1X PBS buffer and then lysed with 1X passive lysis buffer (Promega). The cells were cleared of any cell debris by centrifugation at 14000 rpm for 10 min at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: lrl 1μg of N-terminally FLAG-tagged receptor and 1μg of F22 (Promega, Cat. no: E2301) (for GloSensor assay)
-
Development of a genetically-encoded sensor for probing endogenous nociceptin opioid peptide releasebioRxiv - Neuroscience 2023Quote: HEK293 cells growing at 70% confluency in a 10 cm dish were transfected with wild-type human NOPR or NOPLight (3 µg DNA) and GloSensor-20F (Promega, 2.5 µg DNA) using 12 µL Lipofectamine 2000 (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2020Quote: ... and RNA Tissue Miniprep System (Promega, UK, #Z6112 for tumor samples. GoScript™ (Promega, UK, #A5003) was used for the cDNA synthesis ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tumor cells were transiently transfected with the plasmid using FuGENE HD transfection reagent (#E2311, Promega, USA) according to manufacturer’s protocol and GFP+ cells were sorted ...
-
bioRxiv - Immunology 2024Quote: ... During the experiment tumor growth was monitored weekly by BLI measurement after intraperitoneal (IP) Luciferin (Promega) injection.
-
bioRxiv - Cancer Biology 2024Quote: ... Viability of tumor organoids was assayed using RealTime-Glo™ MT Cell Viability Assay by Promega with heme treated organoids compared to their baseline activity.