Labshake search
Citations for Promega :
1 - 50 of 955 citations for TIM 3 Human HEK 293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: FLAG-β2AR HEK 293 cells were transfected with 3 µg cAMP luciferase plasmid DNA (Promega) using Turbofect (ThermoFisher ...
-
bioRxiv - Cell Biology 2019Quote: ... ‘ΔGsix’ HEK 293 cells were transfected using Fugene 6 (Promega) according to manufacturer specifications.
-
bioRxiv - Biochemistry 2023Quote: HEK-293 stably expressing the Glosensor cAMP reporter (Promega Corp.)21 and epitope-tagged NK1R were seeded in a black-walled 96-well plate flat clear bottom (Corning ...
-
bioRxiv - Biochemistry 2023Quote: HEK-293 stably expressing the Glosensor cAMP reporter (Promega Corp.) 21 and NK1R wide-type or epitope-tagged NK1R were seeded in a white-walled 96-well flat clear bottom plate (Corning #3610 ...
-
bioRxiv - Biochemistry 2020Quote: ... HEK-293 cells were transfected with reporter constructs using FuGENE HD (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK-293 were transfected with NLuc/target fusion constructs using FuGENE HD (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: A Human Embryonic Kidney 293 cell line (HEK 293; ATCC CRL-1573) stably transfected with luciferase-based pGlosensor-22F cAMP reporter plasmid (Glosensor, Promega Corp) has been described previously [GS2257] ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEK-293 cells were transfected with NLuc/target fusion constructs using FuGENE HD (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... HEK-293 PDE4A4 cell media is further supplemented with 500 μg/ml G418 (Promega). Culture conditions were 37°C in a humidified atmosphere with 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: HEK-293 cells transiently transfected with PAR2-YFP or mutant PAR2-YFP (Fugene 6, Promega) were sub-cultured onto 35-mm glass-bottom culture dishes (MatTek Corporation ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK-293 cells were transfected with pmirGLO Dual-Luciferase miRNA Target Expression Vector (1 μg, Promega) containing a control reporter gene Renilla luciferase (hRluc ...
-
bioRxiv - Molecular Biology 2021Quote: HEK-293 cells treated with 1 μM thapsigargin were lysed in 1X Passive Lysis Buffer (Promega) supplemented with Halt™ Protease and Phosphatase Inhibitor Cocktail (ThermoScientific ...
-
bioRxiv - Neuroscience 2023Quote: GFP- or Flag-synapsin constructs were separately transfected into HEK 293 cells using Lipofectamine 2000 (Promega). Transiently transfected cells were washed with PBS and lysed in immunoprecipitation buffer (20 mM HEPES ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK-293 cells were transfected with NanoLuc-COQ8A or NanoLuc-COQ8B fusion constructs using FuGENE HD (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Recombinant sodium channel expressing cell lines were generated by the transfection of wild type and F1579A mutant NaV1.4 BAC DNA constructs into HEK 293 cells (ATCC CRL-1573) by Fugene HD (Promega, Fitchburg, WI) transfection reagent according to the manufacturer’s recommendations ...
-
An advanced automated patch clamp protocol design to investigate drug – ion channel binding dynamicsbioRxiv - Pharmacology and Toxicology 2021Quote: The recombinant rNaV1.4 channel-expressing cell line was generated as described before9 by transfection of rNaV1.4 BAC DNA constructs into HEK 293 cells (ATCC CRL-1573) by Fugene HD (Promega, Fitchburg, WI) transfection reagent according to the manufacturer’s recommendations ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEK 293/T17 cells (ATCC) were transiently transfected with BTK-NanoLuc® fusion vector or NanoLuc®-CRBN fusion vector (Promega) in 0.125 M CaCl2 and 1 x HBS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Cells used for cAMP experiments were produced by PEI-transfection of HEK 293 cells with the commercially available plasmid pGloSensorTM-22F cAMP (Promega, GU174434). Those cells were additionally PEI-transfected with a plasmid containing the information for the adenosine A1 receptor under control of a CMV promoter ...
-
bioRxiv - Cancer Biology 2021Quote: ... lentiviral packaging vectors into human HEK-293T cells via calciumphosphate transfection (Promega; Madison, WI, USA), according to manufacturer’s directions ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK 293T cells were co-transfected with human MOR and a luciferase-based cAMP biosensor (GloSensorTM, Promega). The next day ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 mg of His-Tev-HaloTag-(3C)-human γ-TuNA was coupled to Halo Magne beads (Promega). Xenopus laevis egg extract was prepared by standard methods28 ...
-
bioRxiv - Cancer Biology 2019Quote: ... These were transfected into Tet-On HEK-293TLDcells [10] by incubating 3 µg plasmid DNA with 9 µL Fugene HD (Promega, Madison, WI) in 100 µL Optimem for 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... approximately 200,000 HEK-293T cells were transfected with 1 μg of plasmid DNA complexed to 3 μL of FuGENE HD (Promega, Cat: E2311). 16-20 hours post transfection the cells were dissociated from the plastic using cell dissociation buffer (Gibco Cat ...
-
bioRxiv - Cell Biology 2021Quote: HEK cells were transfected with calcium phosphate (Promega, Profection Mammalian Transfection System) ...
-
bioRxiv - Molecular Biology 2021Quote: HEK-293T cells were transfected using Fugene 6 (Promega), Lipofectamine LTX ...
-
bioRxiv - Genomics 2020Quote: ... HEK 293T were transfected using FugeneHD (Promega, Southampton, UK) with plasmids lentiCRISPR v2 or lenti-EF1a-dCas9-VPR-Puro ...
-
bioRxiv - Cancer Biology 2021Quote: The 3’UTR of human PAQR3 was cloned into pmirGLO vector (Promega, Madison, WI, USA), and then validated by sequencing ...
-
bioRxiv - Immunology 2019Quote: ... These constructs were co-transfected to 293 cells by FugeneHD (Promega). Transfected cells were attached in a 96-well plate and then 0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... WT or mutant promoter of human Rpl28 gene was cloned into pGL-3-basic (Promega, E1751). The number is relative to transcriptional start site ...
-
bioRxiv - Immunology 2024Quote: ... 3×106 ADCC and ADCP Bioassay Effector Cells expressing the human FcγRIIIa or FcγRIIa receptors (Promega) were added per well and the cells were incubated in at 37°C with 5% CO2 for 6 hours ...
-
bioRxiv - Biochemistry 2020Quote: Packaging cells (HEK-293T) were co-transfected using Fugene HD (Promega) according to the manufacturer’s instructions with the packaging vector psPAX2 ...
-
bioRxiv - Neuroscience 2023Quote: HEK-293T cells were transfected with FuGene HD reagent (Promega # E2311) and PSP plasmid ...
-
bioRxiv - Physiology 2023Quote: ... whereas HEK293 cells stably expressing a luminescent cAMP GloSensor (GS-293) (Promega) were previously created in our lab 25 ...
-
bioRxiv - Cancer Biology 2024Quote: ... were cloned into pcDNA3.1-myc-His plasmid (Promega). For sequencing we used a sequence analyser (ABI Prism 3100 Avant ...
-
bioRxiv - Microbiology 2023Quote: ... or the Magne-His purification system (Promega Corporation) for PlzARD-RD per manufacturer protocol ...
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Genetics 2022Quote: ... HEK cells were transfected with 500 ng of plasmid using FuGENE 6 (Promega) following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... were contransfected into HEK 293T cells with FuGene HD transfection reagent (Promega #E2311). 24 hours after transfection ...
-
bioRxiv - Cancer Biology 2024Quote: HEK-293T cells were transfected using the FuGENE® 6 Transfection Reagent (Promega) following the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Cell Biology 2020Quote: HEK 293T cells grown on 10 cm dish were transfected using FuGENE 6 (Promega) with the transfer vector pxPAX2 (Addgene #12260 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2019Quote: ... the His-VqmA was purified using MagneHis Ni-Particles (Promega).
-
bioRxiv - Molecular Biology 2022Quote: ... His-tagged proteins were purified using Ni-NTA resin (Promega); bound proteins were washed with binding buffer and eluted into elution buffer (4 M urea ...
-
bioRxiv - Cell Biology 2024Quote: ... HIS-PLK1 used in ADP-Glo was from Promega (V2841). HIS-PLK1 used in Fig ...
-
bioRxiv - Neuroscience 2023Quote: ... The vector was transfected into Flp-In™ 293 cells using Fugene 6 (Promega, E269A) and 24 hours later the cells expressing the fluorescent reporter were sorted in a 96 well plate as single cells using the Sony SH800 cell sorter ...
-
bioRxiv - Neuroscience 2024Quote: The short TMEM106B 3’ UTR and the long TMEM106B 3’ UTR were amplified from human genomic DNA (H1) and then cloned into the pmirGLO Dual-Luciferase Vector (Promega, E1330) using Gibson assembly ...
-
bioRxiv - Cancer Biology 2021Quote: ... shRNA constructs were packaged in HEK 293T cells using FuGENE 6 Transfection Reagent (Promega E2691) according to manufacturer’s protocol ...