Labshake search
Citations for Promega :
101 - 150 of 1237 citations for Sialic Acid Binding Ig Like Lectin 5 SIGLEC5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... a complete standard mixture of amino acids (Promega, Medison, WI, USA) was analyzed by CE-MS to obtain MS and MS/MS spectra of the proteinogenic amino acids ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-goat alkaline phosphatase-linked antibody and alkaline phosphatase substrate (5-bromo-4-choloro-3-indolyl 1-phosphate and nitroblue tetrazolium) from Promega (Southampton, UK); a hydroxamate-based MMP inhibitor CT-1746 (N1-[2-(S)-(3,3-dimethylbutanamidyl)]-N4-hydroxy-2-(R)-[3-(4-chlorophenyl)-propyl]-succinamide ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated for 24-48hrs in the blocking solution containing chicken anti-human NT-4/5 antibody (10 mg/ ml, Promega, Madison, WI) or rabbit anti-human NT-4/5 (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... For these experiments pGL2M4-luc reporter plasmid37 (containing four CACGTG binding sites, a canonical E-box) and pRL Renilla Luciferase Control Reporter Vectors (CMV, Promega E2231) were used ...
-
bioRxiv - Cancer Biology 2021Quote: MAGI2-AS3 or FOXN3 3’UTR containing miR-452-5p wild-type (WT) or mutant (MUT) binding sites were inserted into psiCHECK vector (Promega, USA). 293T cells were transfected with the constructed luciferase plasmid together with miR-NC or miR-452-5p mimics using Lipofectamine 2000 ...
-
bioRxiv - Developmental Biology 2021Quote: A partial TWD1 fragment of 150 bp covering the TPR domain and a part of the calmodulin binding domains (aa 264-314) was PCR amplified and cloned into pGEM-T-Easy Vector (Promega Corp.) and verified by sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... or without (150 bp) one putative ETV2 binding site (Wei et al, 2010) were cloned into pGL3_Basic vector (Cat# E1751, Promega, Madison, WI). Primers Forward ...
-
bioRxiv - Cell Biology 2021Quote: ... of miR-148a putative binding sites reporter plasmids were constructed using the circMRPS35 and 3’-UTR of STX3 sequences in the psiCHECK2 vector (Promega, USA). For IRES activity analysis ...
-
bioRxiv - Molecular Biology 2019Quote: The 3’ UTR of target mRNAs spanning at least 500 bp around the predicted miRNA binding sites were cloned into the psi-CHECK2 vector (Promega, C8021) downstream of the Renilla luciferase gene (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: FOXM1 3’UTR region comprising of miRNA binding region was cloned into pmirGLO-Dual Luciferase miRNA target expression vector for miRNA luciferase reporter assay (Promega, USA) in MCF-7 cell lines ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Developmental Biology 2020Quote: ... with an added 5’-CACC-3’ at 5’-end and 5’-AAAC-3’ at 5’-end of the complementary strand were annealed in 10xT4 ligation buffer (Promega M1801) by continuous cooling from 95°C to 25°C ...
-
bioRxiv - Microbiology 2020Quote: ... with m7G(5')ppp(5')G RNA Cap Structure Analog (ref. S1404L, Promega) as recommended by the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2mM Mg(OAc)2 and 10μM of the amino acid mixture (Promega). Reactions were incubated with 5μM of the indicated nsp1 protein for 30 min on ice ...
-
bioRxiv - Microbiology 2023Quote: ... 5’-CGCCTTCGTTACAAGCATCG-3’; antisense, 5’-AAGAGCAAACGCATCTCCGA-3’), GAPDH (sense, 5’-ACCCACTCCTCCACCTTTGAC-3’; antisense, 5’-CTGTTGCTGTAGCCAAATTCGT-3’) using Green GoTaq master mix (Promega, Madison, WI) with C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... and the sequence encoding a genetically modified firefly luciferase into which a cAMP-binding domain has been inserted from the pGloSensor-20F (Promega, Cat #E1171).
-
bioRxiv - Cancer Biology 2020Quote: The wild-type 3’UTR region of SALL4 mRNA or a mutant without the miR-205 binding site (Figure 4E) was amplified using PCR and cloned into the pGL3 vector (Promega, Madison, USA). HEK 293T cells were seeded into 24-well plates ...
-
bioRxiv - Bioengineering 2021Quote: ... Cell lysates were pre-cleared of any non-specific streptavidin-binding proteins by incubating with 60 µL of MagneSphere paramagnetic particles (Promega, Madison, WI) for 30 min with rotation ...
-
bioRxiv - Cancer Biology 2019Quote: The GAS5 fragment sequences holding the binding sites of miRNA-106a-5p were synthesized and then inserted into the pGL3 luciferase reporter vector (Promega, WI, USA). HEK293T cells were co-transfected with the constructs encompassing the wild type GAS5 (GAS5-WT ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μL refolding reaction was diluted 1:5 into luciferase assay system mix (Promega), and luminescence was measured on the GloMax-20/20 Luminometer (Promega) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μM HaloTag-TMR (Promega), 47 U/μL Ready Lyse Lysozyme (Epicentre) ...
-
bioRxiv - Microbiology 2021Quote: ... 4 μl 5× Buffer (Promega), 2 μl MgCl2 (25mM) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL Greenflexi buffer (Promega), 2 µL dNTP (Promega U151B ...
-
bioRxiv - Pathology 2021Quote: ... 5 μl MgCl2 solution (Promega), 5 μl of PCR DIG labelling mix (Roche) ...
-
bioRxiv - Biochemistry 2020Quote: ... and 5 µL RNasin (Promega), and tumbling for 2 hours at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... DNase (5 units/ml, Promega)) and incubated 40 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL CellTiter-Flour (Promega) was added per well to measure cell viability and compounds toxicity ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 ng pRL-SV40 (Promega), and 375 ng total amount of testing plasmids individually or in combinations ...
-
bioRxiv - Plant Biology 2021Quote: The optimised HaloTag®-7 sequence (298 amino acids) from Promega (https://www.promega.de/) was genetically split on position 155/156 aa into the N-terminal fragment “NHalo” (aa 1-155 ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by DNA staining with Diamond™ Nucleic Acid Dye (Promega, Madison, WI)
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μl of premix [100 μM amino acid mixture minus methionine (Promega), 100 μM amino acid mixture minus leucine (Promega) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 μl of premix [100 μM amino acid mixture without methionine (Promega), 100 μM amino acid mixture without leucine (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: The putative LINC00662 binding regions within the ELK4 gene were amplified by PCR and cloned into downstream of pmirGLO dual-luciferase vector (Promega, Madison, WI, USA) to form the wide-type plasmid (ELK4-3’UTR-Wt ...
-
bioRxiv - Biochemistry 2021Quote: ... or mutant type (MT) and KCNQ1OT1 binding sites were synthesized and replicated onto a pGL3 Dual□luciferase Target Vector (Promega, Madison, WI, USA), to create Wild Type and Mutant Type let-7a-5p plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... of SNHG16 sequence and the 3’-untranslated region (UTR) fragment of STARD9 containing miR-1301-3p binding site were subcloned into the pmirGLO vectors (Promega, Madison, WI, USA) to generate SNHG16-Wt/Mut vectors and STARD9-Wt/Mut vectors ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 pmol biotinylated RNAs were incubated with streptavidin beads in the binding buffer supplemented with 80 U RNasin (Promega, Germany, Cat. No. N2511) and 50 µg yeast tRNA (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: 2’-Deoxythymidine-5’-triphosphate (dTTP) and 2’-deoxyguanosine-5’-triphosphate (dGTP) were obtained from Promega. 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP ...
-
bioRxiv - Cell Biology 2020Quote: ... in pbs containing 5 mM glucose and supplemented with 5 µM of Nanoglo (Promega #N1120) or coelenterazine-H (Dalton #50909-86-9) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM iodoacetamide (IAA) and proteins were eluted by digestion with 5 µg/ml trypsin (Promega). Eluted proteins were fully digested overnight ...
-
bioRxiv - Microbiology 2019Quote: ... or mCherry were amplified by PCR (5’-CCGGGTACCATGGGCAGCAGCCATCATC and 5’-CGGGAATTCTTACTTGTACAGCTCGTCCAT primers; Pfu DNA polymerase, Promega) from the pRGrectac-NHis constructions (Fernández-Tresguerres et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... Ethylenediaminetetra-acetic acid (EDTA, 0.5 M, pH 8.0) were purchased from Promega (Madison, WI). Lysyl endopeptidase (Lys-C ...
-
bioRxiv - Genomics 2021Quote: ... Total nucleic acid was then treated with DNase I as recommended (20 units; Promega), re-extracted with phenol/Sevag ...
-
bioRxiv - Molecular Biology 2022Quote: ... SYBR Green I nucleic acid gel stain and Go Taq Hot Start Polymerase (Promega). qRT-PCRs were carried out in a QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2022Quote: ... and amniotic fluid using the Viral Total Nucleic Acid Purification Kit (Promega, Madison, WI) on a Maxwell 48 RSC instrument (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... The nucleic acid pellets were resuspended in water and treated with DNAse (RQ1, Promega) for one hour at 37 ºC according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: ... and amniotic fluid using the Viral Total Nucleic Acid Purification Kit (Promega, Madison, WI) on a Maxwell 48 RSC instrument (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... using either the Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega, AS1330) or the Maxwell® RSC miRNA from the Tissue and Plasma or Serum Kit (Promega ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 units GoTaq DNA polymerase (Promega) and water to 50μl ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 μL ADP-Glo reagent (Promega) was added to each reaction mixture and incubated for 40 min at 25°C ...
-
bioRxiv - Biochemistry 2020Quote: ... and 5 µL RNasin Plus (Promega) per sample to 800 µL lysate and 1.5-2 hours of rotation at 4°C ...