Labshake search
Citations for Promega :
1 - 50 of 1126 citations for SARS CoV 2 Spike Glycoprotein S1 Sheep Fc Tag HEK293 Horseradish Peroxidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: 293T cells were co-transfected with pEGFP-N1 and plasmids expressing SARS-CoV-2 Spike (FL) or SARS-CoV-2 Spike-Δ19 for 24 h using FugeneHD (Promega). The cells were treated with DMSO or 10 µM 6-TG at 4 h post- transfection ...
-
bioRxiv - Immunology 2023Quote: ... and the corresponding SARS-CoV-2 spike construct were co-transfected in HEK293-T cells using FuGENE 6 Transfection Reagent (Promega) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Microbiology 2022Quote: ... and a spike-expressing plasmid (pCAGGS-SARS-CoV-2-spike) were co-transfected into HEK293T cells using Fugene HD transfection reagentia (Promega) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: Vero E6 cells were transfected with an GFP expression vector together with either a control expression vector (no spike) or a SARS-CoV-2 spike expression vector using Fugene (Promega). Two hours after transfection ...
-
bioRxiv - Cell Biology 2022Quote: The SARS-CoV-2 spike pseudotyped virus activity was determined by bright-glo luciferase assay (Promega). The plate reader detected the luminescence two days post virus infection or without virus infection ...
-
bioRxiv - Microbiology 2020Quote: ... 18h (SARS-CoV-2) or 24h (SARS-CoV) later by adding 1μM of Coelenterazine-H (Promega) at 1:400 dilution in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... and the SARS-CoV-2 spike protein (23) into HEK 293T cells using the FuGENE 6 Transfection Reagent (Promega). Spike sequences from the following global strains REF were used ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV-2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37 °C with 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV-2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... and TCID50 equivalents determined using a SARS-CoV-2 E gene detection kit (Promega) based upon the Berlin primer/ probe set (70).
-
bioRxiv - Molecular Biology 2021Quote: ... or Horseradish Peroxidase-Conjugated (Promega) secondary antibodies in TBS-T containing 5% non-fat dry milk ...
-
bioRxiv - Cancer Biology 2024Quote: ... Horseradish peroxidase-conjugated secondary antibodies (Promega) and diaminobenzidine (Cell Signaling ...
-
bioRxiv - Cell Biology 2020Quote: ... or SL1-deleted SARS-CoV-2 5’ UTR luciferase reporter plasmid using FuGENE Transfection Reagent (Promega). Luciferase assays were performed using the Luciferase Assay System (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Viral RNA of SARS-COV-2 was detected by TaqMan®-based Real-Time PCR (Promega) using a CDC protocol with two sets of primer/probe which amplifies virus nucleocapsid (N ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-mouse IgG horseradish peroxidase conjugate (Promega). For primary antibody decoration ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-rabbit IgG horseradish peroxidase conjugate (Promega), anti-mouse IgG horseradish peroxidase conjugate (Promega) ...
-
bioRxiv - Genetics 2022Quote: ... Horseradish peroxidase-conjugated anti-mouse-IgG (Promega), anti-rabbit-IgG (Promega) ...
-
bioRxiv - Neuroscience 2020Quote: ... while horseradish peroxidase (HRP)-conjugated anti-rabbit (Promega), Alexa Fluor 555 goat anti-rabbit (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... either with SARS-CoV-2 S and Jun or with ACE2 and Fos plus the pRL Renilla Luciferase (Promega) to normalize the signal ...
-
bioRxiv - Microbiology 2020Quote: ... The 50% tissue culture infectious dose (TCID50) of SARS-CoV-2 pseudovirus was determined using the Steady-Glo luciferase assay system (Promega).
-
bioRxiv - Microbiology 2020Quote: ... In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously26 ...
-
bioRxiv - Immunology 2022Quote: ... In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the GoTaq 1-step qRt-PCR kit (Promega) using 3.8µL of extracted RNA and 6.2µL of RT-qPCR mix that contains 250nM of each primer and 75nM of probe ...
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously [25] ...
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously20 ...
-
bioRxiv - Microbiology 2024Quote: ... Tat and Rev and plasmid encoding spike of SARS-CoV-2 variants Delta or Omicron were transfected in HEK 293T cells using Fugene6 reagent (Cat. No. E2691, Promega) following manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-rabbit IgG-horseradish peroxidase (HRP) (Promega, WI, USA), anti-rat IgG-HRP (GE Healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-mouse horseradish peroxidase (HRP)-conjugated secondary antibody (Promega) (1:10,000 ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-rabbit IgG horseradish peroxidase-linked antibody (Promega, USA) was used as the secondary antibody at 1:10,000–20,000 dilution ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Microbiology 2023Quote: The viral RNA derived from the lung and nasal turbinate samples was quantified using a protocol for quantifying the SARS-CoV-2 sub-genomic E gene RNA (sgE)29 using the GoTaq® Probe 1-Step RT-qPCR System (Promega).
-
bioRxiv - Immunology 2024Quote: ... Quantification of SARS-CoV-2 RVP infection was determined using the Renilla-Glo® luciferase assay system (Promega Corp., Madison, WI). Microtiter assay plates were centrifuged for 5 min at 2000 rpm to prevent cell loss ...
-
bioRxiv - Neuroscience 2019Quote: ... Blots were developed using horseradish peroxidase-conjugated secondary antibodies (Promega) and the ECL chemiluminescence system (Amersham ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Promega) at room temperature for 1 hour ...
-
bioRxiv - Cell Biology 2021Quote: ... Secondary antibodies conjugated to horseradish peroxidase were purchased from Promega, GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... Appropriate secondary horseradish peroxidase conjugated antibodies (Promega, Madison, WI, USA) were applied ...
-
bioRxiv - Genetics 2020Quote: ... and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Promega) at room temperature for 1 hr ...
-
bioRxiv - Microbiology 2022Quote: ... Anti-mouse IgG conjugated with horseradish peroxidase (HRP; Promega, Japan) diluted 1:3000 in Canget signal solution 2 (Toyobo ...
-
bioRxiv - Plant Biology 2023Quote: ... Horseradish peroxidase-conjugated antibodies (anti-rabbit and anti-mouse; Promega) were applied followed by chemiluminescent ECL detection (Amersham ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-rabbit IgG conjugated to horseradish peroxidase (HRP) (Promega) was added and incubated for one h at 37°C ...
-
bioRxiv - Immunology 2021Quote: The effect of neutralization capacity of Multivalent DARPin was evaluated by exposing serial dilutions of the DARPin candidates to increasing titers of SARS-CoV-2 and determining cell protection by CellTiter-Glo assay (Promega, Madison, USA). Serial dilution of DARPin candidates were prepared in 96 well plates in 100 µl cell culture medium (2%-FBS-MEM + HSA ...
-
bioRxiv - Neuroscience 2020Quote: ... Blots have been developed using horseradish peroxidase-conjugated secondary antibodies (Promega) and the ECL chemiluminescence system (Amersham) ...
-
bioRxiv - Microbiology 2021Quote: ... and an anti-rabit IgG conjugated to horseradish peroxidase (HRP) (Promega) was used as a secondary-antibody ...
-
bioRxiv - Plant Biology 2021Quote: ... Blots were developed with horseradish peroxidase (HRP)-linked secondary antibodies (Promega) and Immobilon Western Chemiluminescent HRP Substrate (Merck).
-
bioRxiv - Biochemistry 2024Quote: ... An anti-mouse IgG-horseradish peroxidase (HRP) conjugate (1:3,000 Promega) was used as secondary antibody ...
-
bioRxiv - Microbiology 2022Quote: ... this template was generated from the cDNA of SARS-CoV-2 AI/I-004/2020 using the T7 RiboMAX Express Large Scale RNA Production System (Promega, Madison, WI, USA). The primers and probe used in this study were as follows ...
-
bioRxiv - Bioengineering 2023Quote: ... this template was generated from the cDNA of SARS-CoV-2 AI/I-004/2020 using the T7 RiboMAX Express Large Scale RNA Production System (Promega, Madison, WI, USA). The primers and probe used to detect the WK-521 strain were as follows ...
-
bioRxiv - Biochemistry 2023Quote: ... Bovine alpha-2-hs-glycoprotein was isolated from plasma (Fetuin, Promega, V4961), and monocyte differentiation antigen CD14 was recombinantly expressed in CHO cells (R&D systems ...