Labshake search
Citations for Promega :
1 - 50 of 1156 citations for Retinol Binding Protein RBP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... The binding proteins were eluted by trypsin (Promega Corporation, Madison, WI, USA) for 1 hour at 37°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 200 ng purified recombinant mouse DLX2 protein in Gel Shift Binding Buffer (Promega). Unlabeled probe was added for ‘cold’ competition ...
-
bioRxiv - Bioengineering 2023Quote: ... 2.25 ng/uL Single-Stranded DNA Binding Protein (Sigma, cat# S3917 OR Promega, cat# M301A). 12.5 uL of master mix was mixed with 12.5 uL of 2x input oligonucleotide ...
-
bioRxiv - Cell Biology 2020Quote: ... GST fusion proteins were isolated by binding to glutathione magnetic beads (MagneGST™ Glutathione Particles, Promega) for 30 min at room temperature on a rotating wheel ...
-
bioRxiv - Bioengineering 2021Quote: ... Cell lysates were pre-cleared of any non-specific streptavidin-binding proteins by incubating with 60 µL of MagneSphere paramagnetic particles (Promega, Madison, WI) for 30 min with rotation ...
-
bioRxiv - Biochemistry 2021Quote: ... Halo-tagged ubiquitin-binding domains (UBDs) of TUBE (tandem-repeated ubiquitin-binding entities) was incubated with HaloLink resin (200 μL, Promega) in binding buffer (50 mm Tris⍰HCl ...
-
bioRxiv - Physiology 2023Quote: ... the oligo with NF-κB consensus binding element (Promega) was end-labeled by T4 polynucleotide kinase (Promega ...
-
bioRxiv - Immunology 2022Quote: ... Nonspecific binding was blocked with PBS+ 0.5% Tween® 20 (Promega) + 10% FBS for 2 hours at RT ...
-
bioRxiv - Bioengineering 2021Quote: ... a volume of binding buffer from PCR clean-up kit (Promega, A9282) was added followed by 2 µL (300 ng ...
-
bioRxiv - Cell Biology 2020Quote: ... based on a mutated RIIB cAMP-binding domain from PKA (pGloSensor-20F, Promega), which produces rapid and reversible cAMP-dependent activation of luciferase activity in intact cells and is capable of detecting cAMP elevations in the absence of phosphodiesterase inhibitors ...
-
bioRxiv - Cancer Biology 2023Quote: ... and E2 DNA-binding sites) and to pSV40-luc (pGL3-Control from Promega, containing the SV40 promoter and enhancer regions but no E2 DNA-binding sites) ...
-
bioRxiv - Microbiology 2020Quote: ... Predicted binding sites were cloned and inserted into the pmirGLO vector (Promega, Madison, USA). For reporter assays ...
-
bioRxiv - Biochemistry 2020Quote: ... binding was performed between the soluble fraction (supernatant) and glutathione-conjugated magnetic beads (Promega) pre-equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... the binding solution contains 1.0 µl of NanoLuc substrate stock solution (Promega, Madison, WI, USA). After addition to one well ...
-
bioRxiv - Physiology 2023Quote: ... The DNA binding activity of NF-κB was assayed according to the protocol from Promega Corp ...
-
bioRxiv - Biochemistry 2024Quote: ... an apo-TDO2 binding molecule (structure not disclosed) was coupled to the NanoBRET 590SE (Promega) dye to create a fluorescent tracer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Marinnisen and the pG5 Luc (minimum promoter containing 5 sites for GAL4 binding) was purchased from Promega. The expression plasmid for Nrf2 WT ...
-
bioRxiv - Cancer Biology 2022Quote: ... Annexin V binding to PS was measured using the RealTime-Glo™ Annexin V luminescence assay (#JA1000; Promega), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... After washing with 150 μL of binding buffer four times the samples were subjected to proteolytic digestion using 1.2 μg trypsin (sequencing grade, Promega) for 2h at 47°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... a 3kb region of the promoter containing HIC1 binding sites was amplified by PCR from human genomic DNA and cloned into the pGl4.26-luc vector (Promega); primers are listed in supplementary Table S1 ...
-
bioRxiv - Physiology 2023Quote: The enhancer region containing the FXR binding element was amplified by PCR and cloned into the pGL4.23 vector (Promega). HepG2 cells were transiently transfected with FXR (100 ng/well ...
-
bioRxiv - Molecular Biology 2021Quote: The pGL-AP-1 plasmid containing 6 consensus AP-1 binding sites was co-transfected with the pRL-CMV plasmid (Promega) into cells using TransIT 2020 transfection reagent (Mirus Bio ...
-
bioRxiv - Molecular Biology 2021Quote: The minimal CYC1 promoter with seven tetracycline binding sites was amplified from the yeast Tet-Promoters collection35 with YG4866/YG4867 and cloned into pGEM-Teasy (Promega) to create pCB4695 ...
-
bioRxiv - Microbiology 2020Quote: ... containing the specific primers-probe binding sites were synthesized for NoV GII and cloned into the pGEM-T Vector (Promega) resulting in the NoV-GII plasmids ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Molecular Biology 2019Quote: Validation of hsa-miR-548ba and hsa-miR-7973 direct binding to target gene 3’UTR was performed by using Dual-Glo Luciferase assay system (Promega) according to the user manual ...
-
bioRxiv - Genomics 2020Quote: ... Viral RNA was extracted using the silica guanidinium isothiocyanate binding method (12) adapted for the ThermoFisher Kingfisher using paramagnetic silica particles (Magnesil, Promega).
-
bioRxiv - Developmental Biology 2019Quote: ... together with a TOPFLASH luciferase reporter construct containing synthetic Tcf-binding sites (Korinek et al., 1998) and a Renilla-luciferase reporter (Promega) for normalization ...
-
bioRxiv - Evolutionary Biology 2020Quote: To generate the pGl3-STK38-P luciferase reporter,1.2 kb of DNA upstream the STK38 TTS promoter region with ZNF611 binding motif was amplified by polymerase chain reaction (PCR) and cloned into the Firefly luciferase reporter plasmid pGL3-Basic (Promega) using KPN1 and XHO1 restriction sites.0.7 kb of DNA upstream the STK38 TTS promoter region without ZNF611 binding motif was cloned into pGL3-Basic using same restriction sites to generate the pGl3-STK38-ΔP luciferase reporter ...
-
bioRxiv - Microbiology 2022Quote: ... containing the specific primers-probe binding sites were synthesized for NoV GII and cloned into the pGEM-T Vector (Promega), resulting in the NoV-GII plasmids ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were then digested with LysC at 1ug/100ug protein (Promega) for 3 h at room temperature (RT ...
-
bioRxiv - Plant Biology 2020Quote: ... Fusion proteins were purified using MagnetHis™ protein purification system (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2024Quote: ... Proteins were precipitated through the addition of Protein Precipitation Solution (Promega) followed by vigorous vortexing ...
-
bioRxiv - Biochemistry 2022Quote: ... Mass Spec-Compatible Human Protein Extracts, Cat# V6951) and digested yeast protein extract (Mass Spec-Compatible Yeast Protein Extracts, Cat# V7461) were from Promega, commercial human plasma samples (Human Source Plasma ...
-
bioRxiv - Plant Biology 2022Quote: ... Proteins were purified by using MagneHis™ Protein Purification System (Promega, USA). The peptides of the transporters PDR6 ...
-
bioRxiv - Biophysics 2022Quote: ... Fusion protein was purified using HisLink Protein purification resin (Promega (Madison, WI) #V8821 ...
-
bioRxiv - Cancer Biology 2021Quote: ... For these experiments pGL2M4-luc reporter plasmid37 (containing four CACGTG binding sites, a canonical E-box) and pRL Renilla Luciferase Control Reporter Vectors (CMV, Promega E2231) were used ...
-
bioRxiv - Cancer Biology 2021Quote: MAGI2-AS3 or FOXN3 3’UTR containing miR-452-5p wild-type (WT) or mutant (MUT) binding sites were inserted into psiCHECK vector (Promega, USA). 293T cells were transfected with the constructed luciferase plasmid together with miR-NC or miR-452-5p mimics using Lipofectamine 2000 ...
-
bioRxiv - Developmental Biology 2021Quote: A partial TWD1 fragment of 150 bp covering the TPR domain and a part of the calmodulin binding domains (aa 264-314) was PCR amplified and cloned into pGEM-T-Easy Vector (Promega Corp.) and verified by sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... or without (150 bp) one putative ETV2 binding site (Wei et al, 2010) were cloned into pGL3_Basic vector (Cat# E1751, Promega, Madison, WI). Primers Forward ...
-
bioRxiv - Cell Biology 2021Quote: ... of miR-148a putative binding sites reporter plasmids were constructed using the circMRPS35 and 3’-UTR of STX3 sequences in the psiCHECK2 vector (Promega, USA). For IRES activity analysis ...
-
bioRxiv - Molecular Biology 2019Quote: The 3’ UTR of target mRNAs spanning at least 500 bp around the predicted miRNA binding sites were cloned into the psi-CHECK2 vector (Promega, C8021) downstream of the Renilla luciferase gene (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: FOXM1 3’UTR region comprising of miRNA binding region was cloned into pmirGLO-Dual Luciferase miRNA target expression vector for miRNA luciferase reporter assay (Promega, USA) in MCF-7 cell lines ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... A protein standard (Promega) was added to the non-tagged cells as a known reference of protein concentration to luminescence output ...
-
bioRxiv - Microbiology 2022Quote: ... Protein Precipitation Solution (Promega) was added to the lysate ...
-
bioRxiv - Molecular Biology 2020Quote: ... HaloTag Standard Protein (Promega) was labelled with 10 fold molar excess (5 µM ...
-
bioRxiv - Genetics 2023Quote: ... Protein Precipitation Solution (Promega) was added to the lysed mixture ...
-
bioRxiv - Microbiology 2023Quote: ... Protein precipitation solution (Promega) was added and samples were vigorously mixed ...
-
bioRxiv - Neuroscience 2023Quote: Protein-protein interaction was analyzed using the NanoBit Protein:Protein Interaction (PPI) System (Promega) according to the manufacturer’s instructions ...