Labshake search
Citations for Promega :
101 - 150 of 7512 citations for Recombinant Human Programmed Cell Death 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... or the Magne-His purification system (Promega Corporation) for PlzARD-RD per manufacturer protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.625 μl of recombinant RNasin (Promega), 1 μl of random hexamer primers (Promega ...
-
bioRxiv - Physiology 2019Quote: ... 100 U/mL recombinant RNasin (Promega), 100 μg/mL cycloheximide ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.2U/μL Recombinant RNAsin (Promega, PAN2515), 1% Fatty-acid-free BSA in PBS (Proliant ...
-
bioRxiv - Developmental Biology 2019Quote: ... Tagged-β-Catenin and Tagged-β-Catenin mutants were synthesized using the TNT coupled reticulocyte lysate system according to the manual (Promega, L5020, USA). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant EbfC was expressed in Escherichia coli Rosetta II cells and purified using MagneHis Particles (Promega) as previously described (24 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and human 293T cells as producer cells using the FUGENE HD transfection reagent (Promega), as described [50] ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293 cells were co-transfected with FLAG-tagged receptor constructs and luciferase-based 22F cAMP biosensor (Promega, Cat. no. E2301) using polyethylenimine (PEI ...
-
bioRxiv - Genomics 2020Quote: ... HCT116 Tet-OsTIR1 Scc1-mAID-Halo cells were fluorescently tagged by incubating with 50 nM HaloTag diAcFAM (Promega, cat# G8272) or 500 nM HaloTag JF488 for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transfected with empty pRK5 vector or pRK5 expressing HA-UB (HA-tagged ubiquitin) by using Fugene 6 (Promega), as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... COS-7 cells were individually transfected with mCherry or mCherry-tagged Homer1 (WT, R3E and R3E-ENAH) by ViaFect Transfection Reagent (Promega). Briefly ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2022Quote: Halo-3F-SOCS1 expression was induced with doxycycline overnight (1 μg/mL) and Halo-tagged protein detected by incubation with fluorescent Halo TMR ligand (10 nM; Promega) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: His-P150-CC1 (Courtois et al., 2012) was expressed in and purified from BL21(DE3)pLysS competent cells (Promega) as previously described (Courtois et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 units of recombinant RNAsin (Promega®) and 1 unit/μl Avian Myoblastosis virus reverse transcriptase (Promega® ...
-
Regulation of skeletal muscle metabolism and contraction performance via teneurin-latrophilin actionbioRxiv - Physiology 2021Quote: ... Ultra-Glo recombinant luciferase (Promega, Wisconsin, USA) was added to the media to determine ATP levels ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant RNase inhibitor (0.2 U/μl; Promega, 2% Fatty-acid-free BSA in PBS (Proliant ...
-
bioRxiv - Biochemistry 2023Quote: ... Luciferase refolding assay: QuantiLum Recombinant Luciferase (Promega) was diluted to 55 µM in denaturation buffer containing 6M Guanidium/HCl and 1 mM DTT during 30 minutes at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... 1U/μL Recombinant RNase inhibitor (Promega, PAN2515), and 0.1% Triton X-100) ...
-
bioRxiv - Neuroscience 2020Quote: ... after which beads were washed with 1X High Salt Wash Buffer(50mM Tris-HCl pH 7.4, 350mM NaCl, 1%NP-40 and 1 unit/ul Promega recombinant RNAsin). In the last wash ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human 26S proteasome purified from HEK293 cells was purchased from Promega. The proteasome chaperoning reaction tests were carried out as follows ...
-
bioRxiv - Biochemistry 2023Quote: ... Luminescence from HiBiT-tagged proteins was measured with GloMax Navigator (Promega). Luminescence from CMs and lysates of nontransfected cells were used for background correction.
-
bioRxiv - Biophysics 2024Quote: ... HALO-tagged miniGs was labeled using HALO-JaneliaFluor595 (HALO-JF595) (Promega) by incubating cells in ∼2 μM of HALO-JF595 in DMEM supplemented with 10% FBS for 30 min at 37 °C ...
-
bioRxiv - Biophysics 2019Quote: The cell-viability of human neuroblastoma (SH-SY5Y) cells was measured using MTT cell proliferation assay (Promega, G4000). SH-SY5Y cells were plated in a 96-well plate followed by differentiation in Neurobasal-A ...
-
bioRxiv - Microbiology 2019Quote: ... the His-VqmA was purified using MagneHis Ni-Particles (Promega).
-
bioRxiv - Cell Biology 2024Quote: ... HIS-PLK1 used in ADP-Glo was from Promega (V2841). HIS-PLK1 used in Fig ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HiBit-tagged proteins were detected using the NanoGlo HiBit Blotting kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... recombinant Trypsin was purchased from Promega (WI. USA), Indium-tin-oxide (ITO ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 30 μL Recombinant RNasin Ribonuclease Inhibitor (Promega). Ten milligrams of protein was incubated with 4 μL α-myc antibody (Sigma M4439 ...
-
bioRxiv - Immunology 2021Quote: ... in the presence of recombinant RNase inhibitor (Promega) and concentration was determined (Nanodrop 2000 spectrometer ...
-
bioRxiv - Biochemistry 2023Quote: OuantiLum® Recombinant Luciferase was purchased from Promega. Creatin Kinase from rabbit muscle was purchased from Sigma Aldrich.
-
bioRxiv - Biophysics 2023Quote: ... we added 1.5µL of recombinant RNAsin (Promega N2515) and 6µL of nuclease-free water (Promega P1193 ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 U/μl Recombinant RNasin Ribonuclease Inhibitor (Promega), 45 mM sodium chloride ...
-
bioRxiv - Plant Biology 2024Quote: ... 10μl Recombinant RNasein© Ribonuclease inhibitor (N2515; Promega) was added to inhibit RNaseA activity and samples were flash frozen in liquid nitrogen until analyzed ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNase inhibitor (Recombinant RNasin 20 U/ml; Promega) and 0.15 % Tween-20 ...
-
bioRxiv - Biochemistry 2022Quote: ... the beads with bound recombinant proteins were blocked for 1 h at 4°C using reticulocyte lysate (Promega). Next ...
-
bioRxiv - Synthetic Biology 2023Quote: ... His-tag proteins have been purified by using MagneHis system (Promega) and DynaMag spin magnet (Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 3 nM of either XeARPP19 or various forms of ClyARPP19 (stock solutions at 1 μg/μL) were incubated in the presence of 62.5 units of recombinant bovine PKA (Promega) and 1 mM γS-ATP in a final volume of 30 μL of PKA Buffer (20 mM HEPES pH 7.4 ...
-
bioRxiv - Microbiology 2023Quote: ... HiBiT-tagged proteins were detected using the Nano-Glo HiBiT blotting system (Promega) according to the manual ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell death was determined according to the activity of lactate dehydrogenase (LDH) in the culture supernatants using a CytoTox® Kit (Promega, USA) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... after which D-luciferin-specific Quantilum Recombinant Luciferase (Promega) was added to a final concentration of 25 μg/mL ...
-
bioRxiv - Plant Biology 2019Quote: ... and 20 units of recombinant Rnasin RNase inhibitor (Promega) in a final volume of 20 µl ...
-
bioRxiv - Biochemistry 2019Quote: We also tested aggregation using Quantilum Recombinant Luciferase (Promega), L-malate dehydrogenase (MDH ...
-
bioRxiv - Immunology 2022Quote: ... 200 U/mL Recombinant RNasin® Ribonuclease Inhibitor (Promega), 2 mM DTT) ...
-
bioRxiv - Immunology 2022Quote: ... 200 U/ml Recombinant RNasin® Ribonuclease Inhibitor (Promega), 1 tablet cOmplete™ ...
-
bioRxiv - Microbiology 2023Quote: ... along with 40 units of Recombinant RNasin (Promega, USA). After confirmation of DNA free preparations using PCR ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 5 U of recombinant RNasin (Promega) and 10 U of RQ1 RNase-free DNase (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.5 µl Recombinant RNasin® Ribonuclease Inhibitor (Promega, N251A), 1 µl Reverse Transcriptase (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.5 µl Recombinant RNasin® Ribonuclease Inhibitor (Promega, N251A), 1 µl Reverse Transcriptase (Promega ...