Labshake search
Citations for Promega :
351 - 392 of 392 citations for Recombinant Human NTRK1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Molecular Biology 2020Quote: ... we isolated the sequence-paired sites from the native mouse and human Hes1 and Hes5 genes and cloned these fragments into the promoterless pGL3-Basic vector (Promega). Our synthetic promoters ...
-
bioRxiv - Neuroscience 2022Quote: The scATAC-seq peaks that overlapped obesity-associated SNPs were PCR amplified from human genomic DNA (see primers in Supplementary Table 2) and cloned into the pGL4.23 plasmid (Promega, E84111). The associated SNPs were then introduced into these plasmids by PCR amplification with primers containing the associated variants ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequence was amplified from human genomic DNAs and used as in vitro transcription template in the reaction using Riboprobe System-T7 Kit (P1440, Promega) in the presence of 0.4μL 5-(3-Aminoallyl)-uridine-5’-triphosphate labeled with ATTO 680(Aminoallyl-UTP-ATTO-680 ...
-
bioRxiv - Biochemistry 2022Quote: ... GS-mediated GS-cAMP accumulation assays were performed with HEK293T (ATCC CRL-11268) cells transiently expressing human D1R or D5R wild-type and mutant along with the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20 000 cells/35 μL/well ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we amplified FES exons 9 to 11 with intervening sequences and SH3BP2 exons 9 to 11 with intervening sequences from human genomic DNA (Promega), and cloned the products into pcDNA3.1(+ ...
-
bioRxiv - Molecular Biology 2023Quote: The sequences of wild-type (WT) F8 exons and 100-250 nucleotides flanking each exon were amplified from human genomic DNA (Promega) using WT PCR primers shown in Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1,200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends in pCI mammalian expression vector (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Immunology 2023Quote: Pyroptotic cell death was measured by assessing LDH-release in the cell culture supernatant of human and murine macrophages using a CytoTox 96 Non-radioactive Cytotoxic Assay (Promega) following the manufacturer’s recommended procedures.
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: All human-derived cell lines were validated by short tandem repeat (STR) profiling using PowerPlex® 16 HS System (Promega) once a month ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragments were PCR-amplified with primer pairs containing a XhoI and BamHI site from human genomic DNA (Promega) and subcloned into the pCLL-NoPromoter-FLuc-CMV-RLuc-dsRed2 vector ...
-
bioRxiv - Developmental Biology 2024Quote: ... Total peptide concentration was adjusted to 0.15 µg/µL according to the absorbance at 280 nm against a Mass Spec-Compatible Human Protein Extract/Digest calibration curve (Promega), using the Thermo Nanodrop 1000 ND-1000 spectrophotometer (Thermo Fisher).
-
bioRxiv - Cell Biology 2020Quote: ... and SERBP1 were amplified from human cDNA and cloned into the appropriate vectors (pACT or pBIND) provided by the CheckMate Mammalian Two-Hybrid kit (Promega E2440). The appropriate combination of edited pACT and pBIND vectors ...
-
bioRxiv - Genomics 2020Quote: ... standard curves were generated by preparing 10 fold dilution series of plasmid DNA containing parasite 18SrRNA gene54 and from human genomic DNA (Cat No. G304, Promega, Australia). Thermal cycling was performed on a Light Cycler 480 II (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... or human IFN-β (1000 U/ml) and firefly luciferase activity was determined using the dual luciferase reporter assay system (Promega) on Cytation 3 (BioTek ...
-
bioRxiv - Immunology 2022Quote: The constant regions of the human TCR genes were replaced with murine constant genes by overlapping PCRs as previously described,14 and the human/murine hybrid TCR genes were sub-cloned into the pGEM-4Z vector (Promega Corporation) for mRNA expression ...
-
bioRxiv - Immunology 2022Quote: ... pneumoniae D39 or the isogenic mutants towards human epithelial cells was accessed using a CellTiter-Blue® (CTB) Cell Viability Assay (Promega), according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were blocked with PBS containing 5% skim milk and incubated with HRP-conjugated anti-human IgG1 antibodies (Promega, #W403B) overnight at 4 °C.
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Neuroscience 2024Quote: The short TMEM106B 3’ UTR and the long TMEM106B 3’ UTR were amplified from human genomic DNA (H1) and then cloned into the pmirGLO Dual-Luciferase Vector (Promega, E1330) using Gibson assembly ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was isolated from the 102 human FFPE colorectal tissue samples using the Maxwell® RSC Blood DNA Kit (Promega) on a Maxwell® 16 MDx (Promega) ...
-
bioRxiv - Microbiology 2021Quote: DNA extraction of samples was performed according to an adapted version of the “DNA purification from human feces using the Maxwell® RSC instrument and the Maxwell® RSC PureFood GMO and Authentication Kit” developed by Promega (Promega Corporation ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-untranslated region (3’-UTR) fragment of IκBα (human/rat) was inserted into the pGL3-basic vector (firefly luciferase; Promega, Madison, WI, USA), which was obtained from General Biosystems (Anhui ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were co-transfected in a 1:1 ratio with either human D1 or D2Long receptor and a split-luciferase based cAMP biosensor (GloSensor, Promega, Durham NC). The next day ...
-
bioRxiv - Molecular Biology 2021Quote: ... RPGR wild-type minigene construct was generated (Figure 2A) by amplification from a pool of human female genomic DNAs (Promega, Milan, Italy) using the following primers:
-
bioRxiv - Biophysics 2022Quote: pHalo-PPARγ2 expresses human PPARγ isoform 2 fused to HaloTag in the N-terminus under a CMVd1 promoter (Promega ORF clone #FHC08305). PPARγ2 mutants were generated by nucleotide substitution using the QuikChange II XL Site Directed Mutagenesis Kit (Stratagene ...
-
bioRxiv - Microbiology 2022Quote: The extent of ADCC activation induced by human γ-globulins was evaluated with the use of an ADCC Reporter Bioassay (Core Kit; Promega, G7010) and the EnSpireMultimode Plate Reader (PerkinElmer) ...
-
bioRxiv - Cell Biology 2023Quote: ... the corresponding promoter regions of the human KLF2 and KLF4 genes were amplified using human genomic DNA as a template and cloned into the BglII site of the GL4 basic vector (Promega, Fitchburg, WI). Point mutants of the vectors were constructed by site-directed mutagenesis using a QuikChange Site-Directed Mutagenesis kit (Stratagene ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated for 24-48hrs in the blocking solution containing chicken anti-human NT-4/5 antibody (10 mg/ ml, Promega, Madison, WI) or rabbit anti-human NT-4/5 (1:1000 ...
-
bioRxiv - Immunology 2024Quote: ... qPCR targeting the β-globin gene was performed for each sample and evaluated alongside a β-globin calibration curve (human gDNA, cat# G1521, Promega).
-
bioRxiv - Cancer Biology 2021Quote: ... short tandem repeat analysis verified the identity of mouse (Bioassay Methods Group, National Institute of Standards and Technology) and human (Promega GenePrint 10 System) cells.
-
bioRxiv - Microbiology 2019Quote: ... These stock solutions were then diluted to the indicated concentrations in sequencing-grade water and 10 ng commercial human DNA (Promega Corp cat#G3041) was added to all samples ...
-
bioRxiv - Synthetic Biology 2022Quote: Cytotoxicity assay was performed on HCT116 human colon cells (ATCC, #CCL-247™) using CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega, #G3580) which is a colorimetric method based on MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2- (4-sulfophenyl)-2H-tetrazolium ...
-
Development of a genetically-encoded sensor for probing endogenous nociceptin opioid peptide releasebioRxiv - Neuroscience 2023Quote: HEK293 cells growing at 70% confluency in a 10 cm dish were transfected with wild-type human NOPR or NOPLight (3 µg DNA) and GloSensor-20F (Promega, 2.5 µg DNA) using 12 µL Lipofectamine 2000 (Thermo Fisher ...
-
bioRxiv - Systems Biology 2023Quote: ... Peptide loading was assessed by comparing the intensity of the total ion current to 200 ng of a human K562 whole cell lysate standard (Promega, Madison, Wisconsin, USA) prepared at 0.2 μg/μL.
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... 24h prior to imaging cells were co-transfected with human PEX31-42-GFP-Halo and either human HAP1-mCherry-eDHFR or mouse BICD21-572-mCherry-eDHFR using FuGENE 6 (Promega; 1 µg total DNA) and 48h prior to imaging with control siRNA using Lipofectamine RNAiMAX (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Standard curves for each primer set were generated using serially diluted plasmid (for gAAV) or Human and Mouse Genomic DNA (for host) (Promega G1521 and G3091, respectively) and used for quantification ...
-
bioRxiv - Biochemistry 2024Quote: The upstream promoter region of the human ORAI1 gene with the putative G4-forming sequence ORAI1-Pu was amplified by PCR using human genomic DNA as a template and then cloned into the pGL4.72[hRlucCP] vector (Promega; Madison, USA; catalog no. E6901) at the KpnI/HindIII site ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Comparison of VUF15485-induced β-arrestin2 recruitment to human and mouse ACKR3 was also measured by NanoLuc complementation assay (NanoBiT, Promega Corporation, Madison, WI, USA) in HEK293T cells (Dixon et al. ...