Labshake search
Citations for Promega :
351 - 400 of 439 citations for Recombinant Human Membrane Metallo Endopeptidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Reference allele enhancer sequences for hZRS and hs737 were obtained via PCR cloning from human genomic DNA (Promega, G304A). Primers used for each enhancer sequence are outlined in Table S2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cell surface levels of HiBiT-tagged human S1PR1 were monitored using a Nano Glo HiBiT Extracellular Detection System (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: IDH1 and NNT promoter sequences were amplified from genomic DNA of human primary melanocytes by PCR and cloned into pGL4.12 (Promega). Mutagenesis of E-boxes was performed using a QuikChange Site-Directed Mutagenesis Kit (Stratagene) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Molecular Biology 2019Quote: ... Infected cell death was quantified by the release of the cytosolic enzyme LDH into the culture supernatant at 24h post-infection using the CytoTox-ONE Homogeneous Membrane Integrity Assay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins separated on the second gel were transferred to a PVDF membrane and DivJ levels were measured using Western blots by probing the protein with anti-HaloTag antibody (Promega). Due to the requirement of growing cells in low phosphate media ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Proteins were transferred by semi-dry Western Blot onto PVDF membranes visualised with polyclonal antibody and BCIP/NBT (Promega, S3771).
-
bioRxiv - Genomics 2021Quote: ... Membranes were washed three times in TBS-T before incubating with secondary antibodies (HRP-anti Mouse-IgG (H+L) (Promega)) for 45 min in TBS-T and 2% milk ...
-
bioRxiv - Immunology 2021Quote: Toxicity was measured by quantifying the cell viability using the CytoTox-ONE™ Homogeneous Membrane Integrity Assay kit (Promega, G7891) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a membrane GFP (75 ng as control for transfection) using FuGENE HD transfection reagent (1µg DNA/1µL FuGENE) (Promega, WI, USA). Next ...
-
bioRxiv - Neuroscience 2023Quote: LDH release from macrophages treated with Aβ profect complexes was measured using the CytoTox-ONE Homogeneous Membrane Integrity Assay (cat no: G7891, Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... in-gel digestion was performed on the PNS and enriched peroxisomal membranes using 300 ng trypsin (sequencing grade modified trypsin V5111; Promega) after reduction with 10 mmol/L dithiothreitol and alkylation with 55 mmol/L iodoacetamide proteins as described previously (Wolters et al. ...
-
bioRxiv - Biophysics 2024Quote: ... 8 μl of the terminated reaction mixture were then applied to a streptavidin biotin capture membrane (SAM2, Promega, Cat.# V2861) and further treated following the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2024Quote: pCS2+ expression vectors carrying membrane-localized fluorescent CAAX-GFP (mGFP) or Utrophin-RFP (utr-RFP) were linearized using restriction enzymes (Promega) for two hours at 37°C and precipitated at -20°C overnight in 70% ethanol ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total genomic DNA extracted from liver mouse and HEK293 cells were used as templates for PCR-cloning of the mouse/human promoter/intron fragments into the KpnI/MluI sites of pGL3 basic luciferase reporter vector (Promega). The glutamic acid (E ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 3.6 kbp human CDC37 promoter region was PCR amplified and subcloned into a pGL3-luciferase vector (Promega, Madison, WI) using KpnI and BamHI ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... were co-transfected with pcDNA5/FRT construct encoding haemagglutinin (HA)-tagged human CB1 receptor cDNA and pOG44 (Flp recombinase plasmid) using transfection reagent Fugene HD (Promega) as previously described for AtT-20 pituitary tumour cells [26] ...
-
bioRxiv - Genomics 2019Quote: To generate recombinant p53 we in vitro transcribed/translated human p53 with a c-terminal HA tag using a rabbit reticulocyte system (Promega). To generate fragmented genomic DNA we tagmented 50ng of human genomic DNA from MCF7 cells using the MuSeq kit (Thermo ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Physiology 2021Quote: ... Plasmid DNAs coding for hSlo1 (AAB65837 in pCI-neo) and human β1 (AAH25707) or β4 (KJ893642) were transfected into the cells with either FuGene6 (Promega) or GenJet v ...
-
bioRxiv - Biochemistry 2021Quote: ... yeast (Saccharomyces cerevisiae) cell protein extract (Cat# V7341, V7461), and human K562 cell protein extract (Cat# V6951, V6941) were purchased from Promega Inc (WI ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression in the tumor was analyzed by using human primers using SYBR green gene expression assays (GoTaq qPCR Master Mix, A6002, Promega).
-
bioRxiv - Immunology 2020Quote: ... pCAG-Flag or pCMV-HA-N expression vectors using standard molecular cloning methods as described in our previous publications.30–32 The IFN-β luciferase reporter plasmid pGL3-IFN-β-Luc vector was constructed in our previous study.33,34 The IFNλ1 luciferase reporter plasmid pGL3-IFNλ1-Luc was constructed by inserting the 1000-bp promoter region of human IFNλ1 (nucleotides −1000 to +1, with the translation start site set as 1) into pGL3-Basic (Promega, USA) according to methods outlined in previous studies.13,34 The ISG luciferase reporter plasmid pISRE-Luc vector was purchased from Clontech (USA) ...
-
bioRxiv - Molecular Biology 2020Quote: A putative promoter region of 600bp encompassing the TSS of the human VDACs genes was selected from GenBank and cloned into pGL3 basic vector (Promega) for transcriptional activity study ...
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Molecular Biology 2020Quote: ... we isolated the sequence-paired sites from the native mouse and human Hes1 and Hes5 genes and cloned these fragments into the promoterless pGL3-Basic vector (Promega). Our synthetic promoters ...
-
bioRxiv - Neuroscience 2022Quote: The scATAC-seq peaks that overlapped obesity-associated SNPs were PCR amplified from human genomic DNA (see primers in Supplementary Table 2) and cloned into the pGL4.23 plasmid (Promega, E84111). The associated SNPs were then introduced into these plasmids by PCR amplification with primers containing the associated variants ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequence was amplified from human genomic DNAs and used as in vitro transcription template in the reaction using Riboprobe System-T7 Kit (P1440, Promega) in the presence of 0.4μL 5-(3-Aminoallyl)-uridine-5’-triphosphate labeled with ATTO 680(Aminoallyl-UTP-ATTO-680 ...
-
bioRxiv - Biochemistry 2022Quote: ... GS-mediated GS-cAMP accumulation assays were performed with HEK293T (ATCC CRL-11268) cells transiently expressing human D1R or D5R wild-type and mutant along with the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20 000 cells/35 μL/well ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we amplified FES exons 9 to 11 with intervening sequences and SH3BP2 exons 9 to 11 with intervening sequences from human genomic DNA (Promega), and cloned the products into pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2022Quote: ... 1200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends53 in pCI (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: HEK293T cells were transfected with a FLAG-tagged human DHHC20-expressing plasmid and a corresponding HA-tagged substrate-expressing plasmid using FuGENE transfection reagent (Promega) and incubated overnight ...
-
bioRxiv - Molecular Biology 2023Quote: The sequences of wild-type (WT) F8 exons and 100-250 nucleotides flanking each exon were amplified from human genomic DNA (Promega) using WT PCR primers shown in Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1,200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends in pCI mammalian expression vector (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Immunology 2023Quote: Pyroptotic cell death was measured by assessing LDH-release in the cell culture supernatant of human and murine macrophages using a CytoTox 96 Non-radioactive Cytotoxic Assay (Promega) following the manufacturer’s recommended procedures.
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: All human-derived cell lines were validated by short tandem repeat (STR) profiling using PowerPlex® 16 HS System (Promega) once a month ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragments were PCR-amplified with primer pairs containing a XhoI and BamHI site from human genomic DNA (Promega) and subcloned into the pCLL-NoPromoter-FLuc-CMV-RLuc-dsRed2 vector ...