Labshake search
Citations for Promega :
601 - 650 of 1245 citations for Recombinant Human Lysyl Oxidase Like 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were performed using a 2× GoTaq PCR master mix (Promega), biotin-labeled M13F and biotin-labeled M13R primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of expressing plasmids were transfected using Fugene HD (Promega, #E2311). After 24 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2mM Mg(OAc)2 and 10μM of the amino acid mixture (Promega). Reactions were incubated with 5μM of the indicated nsp1 protein for 30 min on ice ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA (2 μg) was treated with RQ1 DNase (Promega, Madison, Wisconsin) and reverse-transcribed with the SuperScript VILO cDNA Synthesis Kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... A transfection solution containing 2 μl oligo-fectamine (Promega, Madison, WI, USA), 40 μl MEMI ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and were incubated with Glosensor reagent (Promega, 7.5 μL, 2% final concentration) for 90 min at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... All hADAR1/2 fragments were cloned into the pCI-Neo vector (Promega) to generate the pCI-ADAR vectors ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM DTT] containing 0.5 mM of freshly added rATP (Promega, E6011) in 10-μl reactions ...
-
bioRxiv - Cancer Biology 2021Quote: ... the samples were digested overnight with 2 μg sequencing grade trypsin (Promega) and trypsin inactivated by adding TFA to a final concentration of 1% v/v ...
-
bioRxiv - Molecular Biology 2021Quote: 50 nl of reverse transcription mix (2 mM (each) dNTP mix (Promega) and 0.8 Units Superscript III (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... On odd days 30 μl of Cell TiterGlo 2 (Promega cat # G924A) was added to the remaining 40 μl culture and incubated 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... in 2× SSC supplemented with 3% (vol/vol) RNasin Ribonuclease inhibitor (Promega), 6% (vol/vol ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mL of Halo Magne bead slurry (cat. #G7287, Promega, Madison, WI) were washed with MilliQ water and 3 CV of modified CSF-XB ...
-
bioRxiv - Biochemistry 2021Quote: ... the samples were digested by addition of 2 % (w/w) trypsin (Promega) over night at 37°C ...
-
bioRxiv - Genetics 2019Quote: ... 1 mM CaCl2 with 2 ug trypsin (Promega, Madison, WI, product V5111). Digest was stopped with formic acid ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The Nano-Glo Luciferase Assay Substrate furimazine (2 µl ml-1, Promega) was added and the luminescence was measured on a luminometer (Mithras LB 940 Berthold Technologies plate reader ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μl 5X colorless GoTaq reaction buffer (containing 7.5 mM MgCl2) (Promega), 6.225 μl deionized water ...
-
bioRxiv - Genomics 2019Quote: ... and 2 units (5 U/μl) of GoTaq polymerase (Promega, Madison, Wisconsin). PCR products were separated following agarose gel electrophoresis ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were incubated with 2% of the GloSensor reagent (Promega, cat. # E1290). Relative luminescence units were recorded using a SynergyMx microplate reader (Biotek) ...
-
bioRxiv - Genetics 2020Quote: ... cells were transfected with 50 ng/well of the psiCHECK-2 (Promega) construct using the FuGENE HD Transfection Reagent (Promega) ...
-
bioRxiv - Genetics 2019Quote: ... and 2 units (5 U/μl) of GoTaq polymerase (Promega, Madison, Wisconsin). The PCR amplicons were applied onto a 2% agarose gel with appropriate controls and markers.
-
bioRxiv - Microbiology 2022Quote: ... On-bead digestion was performed using sequencing-grade trypsin (2 μg; Promega) in 2 M urea in 100 mM triethylammonium bicarbonate (TEAB ...
-
bioRxiv - Systems Biology 2022Quote: ... Samples were shortly cooled to room temperature and 2 µl LysC (Promega) added pre-diluted in ultra-pure water to 2 ng/µl and digested for 4 h at 37°C in the thermal cycler ...
-
bioRxiv - Neuroscience 2023Quote: ... before introduction of 2 μl seeds (diluted 1:5) using MultiFectam (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were digested with 2 μg of trypsin (Promega, Madison, WI, USA) at 47°C for 2 h ...
-
bioRxiv - Cell Biology 2023Quote: ... and treated with 2 units of calf intestinal alkaline phosphatase (Promega; M182A) at 37°C for 10 min at 1000 rpm in a Thermomixer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dual Luciferase assay kit and PsiCHECKTM-2 vector were purchased from Promega. Oligonucleotides were synthesized and obtained from Eurofins Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... and digested for 2 hours at 50°C using Trypsin Platinum (Promega) using 1:50 Trypsin to sample ratio by mass ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... supplemented with 1 mM CaCl2 and digested with 2 μg trypsin (Promega) for 15 h at 37ᵒC ...
-
bioRxiv - Biochemistry 2023Quote: ... and incubated in 2 nM JF549-Halo-ligand (Cat. No. GA1110; Promega) for 15 minutes at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... Bovine alpha-2-hs-glycoprotein was isolated from plasma (Fetuin, Promega, V4961), and monocyte differentiation antigen CD14 was recombinantly expressed in CHO cells (R&D systems ...
-
bioRxiv - Cancer Biology 2023Quote: ... and program DLR-2-INJ on a Glomax 20/20 Luminometer (Promega) with 20μl cell extract as the input.
-
bioRxiv - Biochemistry 2024Quote: ... alkylated with 2-iodoacetamide and digested with Endopeptidase Trypsin (sequencing grade, Promega) overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... we added 10μL Cell Titer Glo reagent diluted 1:2 (Promega, Inc.) to each well and mixed ...
-
bioRxiv - Biochemistry 2023Quote: ... and proteolysis was performed by adding either 2 μg of trypsin (Promega) or a combination of 2 μg of trypsin and 0.2 μg of LysC (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... and SERBP1 were amplified from human cDNA and cloned into the appropriate vectors (pACT or pBIND) provided by the CheckMate Mammalian Two-Hybrid kit (Promega E2440). The appropriate combination of edited pACT and pBIND vectors ...
-
bioRxiv - Genomics 2020Quote: ... standard curves were generated by preparing 10 fold dilution series of plasmid DNA containing parasite 18SrRNA gene54 and from human genomic DNA (Cat No. G304, Promega, Australia). Thermal cycling was performed on a Light Cycler 480 II (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... or human IFN-β (1000 U/ml) and firefly luciferase activity was determined using the dual luciferase reporter assay system (Promega) on Cytation 3 (BioTek ...
-
bioRxiv - Immunology 2022Quote: The constant regions of the human TCR genes were replaced with murine constant genes by overlapping PCRs as previously described,14 and the human/murine hybrid TCR genes were sub-cloned into the pGEM-4Z vector (Promega Corporation) for mRNA expression ...
-
bioRxiv - Immunology 2022Quote: ... pneumoniae D39 or the isogenic mutants towards human epithelial cells was accessed using a CellTiter-Blue® (CTB) Cell Viability Assay (Promega), according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were blocked with PBS containing 5% skim milk and incubated with HRP-conjugated anti-human IgG1 antibodies (Promega, #W403B) overnight at 4 °C.
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Neuroscience 2024Quote: The short TMEM106B 3’ UTR and the long TMEM106B 3’ UTR were amplified from human genomic DNA (H1) and then cloned into the pmirGLO Dual-Luciferase Vector (Promega, E1330) using Gibson assembly ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was isolated from the 102 human FFPE colorectal tissue samples using the Maxwell® RSC Blood DNA Kit (Promega) on a Maxwell® 16 MDx (Promega) ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μg of plasmid was transfected using Fugene HD (Promega, Madison WI, #E2311). Plasmid DNA was mixed with 8 µL Fugene and 100 µL media and incubated at room temperature for 15 minutes before being added to cells ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were digested by 2 h Trypsin/Lys-C mix incubation (V5073, Promega) and collected ...
-
bioRxiv - Cancer Biology 2021Quote: ... and real-time PCR using GoTaq 2-Step RT-qPCR kit (Promega, A6110). All measurements were normalized against Actin as the internal control using the 2-ΔΔCt method (Figure 1—source data 3 and Figure 3—source data 2) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 µl of 5x SSIV buffer and 2 µl of DNase (RQ1, Promega) was added ...