Labshake search
Citations for Promega :
101 - 150 of 2777 citations for Recombinant Human Interleukin 1 Beta since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 500 ng human genomic DNA (Promega) or 5 μl of untreated or RNase-treated nasal swab nucleic acid isolates ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pooled human male genomic DNA (Promega) was randomly sheared (500-800bp ...
-
bioRxiv - Systems Biology 2021Quote: ... a human cDNA pool (Promega Corporation), or obtained as synthesized double-stranded DNA fragments (gBlocks ...
-
bioRxiv - Genomics 2021Quote: ... 50ng human genomic DNA (Promega, G304A), 2µM assembled T7-Tn5 transposase or Tn5 transposase was incubated at 55 °C for 7minutes ...
-
bioRxiv - Immunology 2023Quote: ... Lumit Human IL-1β Immunoassay (Promega) was performed according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... human Female genomic DNA (Promega #G1521), as a reference ...
-
bioRxiv - Developmental Biology 2019Quote: ... Cell lysates were harvested the day after and luciferase and β-galactosidase activities were measured using Luciferase Reporter and Beta-Glo Assay Systems (Promega) following the manufacturer’s guidelines ...
-
bioRxiv - Developmental Biology 2021Quote: ... or experimental constructs along with the ptcΔ136-GL3 luciferase reporter construct and beta-galactosidase transfection control (pSV-β-galactosidase; Promega, E1081).
-
bioRxiv - Developmental Biology 2019Quote: ... we produced recombinant H3 mutant proteins from mRNAs using rabbit reticulocyte lysate (Promega L4600). After 3h of incubation at 4°C in interphase extracts followed by another 3h incubation with anti-HA beads ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 200 ng purified recombinant mouse DLX2 protein in Gel Shift Binding Buffer (Promega). Unlabeled probe was added for ‘cold’ competition ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were resuspended in reaction buffer [RNase inhibitor (0.2U/μL Recombinant RNAsin (Promega, PAN2515), 1% Fatty-acid-free BSA in PBS (Proliant ...
-
bioRxiv - Biochemistry 2024Quote: ... The HaloTag-JF503-SWSAP1 was quantified by using recombinant HALO-GFP protein standard (Promega) pre-incubated with JF503 at a 1:1 molar ratio and titrated into single molecule buffer (20 mM Tris pH7.5 ...
-
bioRxiv - Microbiology 2024Quote: Recombinant FIKK kinase domains activity was measured using the ADP-Glo kinase assay (Promega), which quantifies the amount of ADP produced during the kinase reaction ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 ng/μl of mRNA and 6 ng/μl QuantiLum Recombinant Luciferase protein (Promega) were coinjected ...
-
bioRxiv - Microbiology 2022Quote: ... the media was replaced with complete MEM (without NH4Cl) and cells incubated an additional 48 hours Transduced (LacZ+) cells were quantified using the Beta-Glo Assay System (Promega, Madison, Wisconsin) following the manufacturers’ protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... LacZ reporter activity was assayed in defined media (SD) supplemented with -Leu-Trp using the Beta-Glow® Assay System following commercially available protocols (Promega #E4720). In short ...
-
bioRxiv - Microbiology 2020Quote: Recombinant TgGat1 (0.625-2.5 µM) was incubated with a given UDP-sugar (50 µM) (Promega) in 50 mM HEPES-NaOH (pH 7.4) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... QuantiLum Recombinant Luciferase and the BrightGlo Luciferase Assay System were acquired from Promega (Madison, WI). The HIV-1 inhibitor temsavir was acquired from ViiV Healthcare (Brentford ...
-
bioRxiv - Microbiology 2021Quote: ... recombinant TgPDEs or immunoprecipitated TgPDEs were assayed using the PDE-Glo Phosphodiesterase Assay kit (Promega) according to the manufacturer’s instructions with a few modifications ...
-
bioRxiv - Systems Biology 2019Quote: Cells were lysed and recombinant proteins were isolated using Magne® HaloTag® Beads (Promega) as previously described (15) ...
-
bioRxiv - Immunology 2020Quote: ... Mice were tested individually in duplicates by stimulation with recombinant luciferase (13μg/ml, Promega, #E1701), SARS-CoV-2 spike protein (10μg/ml) ...
-
bioRxiv - Plant Biology 2023Quote: ... in the presence of 20 units of RNasin (Recombinant Ribonuclease Inhibitor, Cat. No. C2511; Promega) and dNTP mix at a final concentration of 0.5 mM of each dNTP (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... all the steps were done in the presence of RNase inhibitor (recombinant RNasein, Promega, N2511) diluted 1:4,000 for washing steps or 1:400 for incubation while staining and for buffers in the tubes containing the sorted cells followed by snap freeze and storage at –80°C.
-
bioRxiv - Biochemistry 2023Quote: ... 10 μg of the isolated recombinant bacmid and 5 μL Fugene HD transfection reagent (Promega) were diluted in 150 μL Sf-900™ III SFM ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Promega, Madison, WI, USA) was diluted to 10,000 genome copies per μl then serially diluted to 10 genome copies per μl and used to create a human DNA copy number standard curve ...
-
bioRxiv - Molecular Biology 2019Quote: ... The natural templates include purified human (Promega), rhesus monkey (BioChain) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human Genomic DNA Male (Promega, cat # G1471) and IDH1 R132H Reference Standard (Horizon ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50ng of normal human genomic DNA (Promega) was used as a negative control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human LAMA1 cDNA was purchased from Promega and sub-cloned into pLVX-Tet-On Advanced vector (Clontech) ...
-
bioRxiv - Genomics 2021Quote: Commercial human DNA (Promega, Cat. No. G1521) was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1 ...
-
bioRxiv - Microbiology 2023Quote: ... Human gDNA (Promega, San Luis Obispo, CA) was added to the extracted gDNA from the clinical swabs to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Immunology 2022Quote: ... These included 5μg/ml human gDNA (Promega), 500ng/ml citrullinated histones (Cayman Chemical #501620) ...
-
bioRxiv - Genomics 2023Quote: ... Human male genomic DNA (Promega, CAT #G1471) was used for a standard curve at 125 pg/µL ...
-
bioRxiv - Biochemistry 2024Quote: ... a K562 human peptide digest standard (Promega) and E.coli peptide standard (Waters ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Developmental Biology 2019Quote: ... We measured LacZ reporter activity using the Beta-Glo® Assay System following the commercially available protocols and the yeast literature (Promega, Madison, WI) (Hook ...
-
bioRxiv - Cell Biology 2021Quote: ... confirmed by positive beta-galactosidase staining and decreased proliferation rate (31) were transfected with peflin siRNA using Transfast (Promega Corp., Madison WI, USA) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: To investigate enzymatic activity of recombinant PfGSK3 a commercial luminescence-based kinase assay (KinaseGlo Plus, Promega) was used as previously described (93) ...
-
bioRxiv - Molecular Biology 2021Quote: ... These recombinant plasmids were subsequently used to generate digoxigenin-labelled riboprobes using the Riboprobe System (Promega) with SP6 or T3 RNA polymerases and digoxigenin-labelled Uracil triphosphate (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant EbfC was expressed in Escherichia coli Rosetta II cells and purified using MagneHis Particles (Promega) as previously described (24 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... bulked to 200ng using human genomic DNA (Promega). All samples were sheared for 150 seconds using a Covaris E220 (Duty Factor 5% ...
-
bioRxiv - Systems Biology 2020Quote: The Human cell lysate was obtained commercially (Promega) and the yeast digest was prepared as previously described23 ...
-
bioRxiv - Genomics 2019Quote: ... We added 4μl pooled commercial human gDNA (Promega) to all samples to ensure total gDNA > 1μg/35μl ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... Human GSK-3β was purchased from Promega (V1991).
-
bioRxiv - Genomics 2020Quote: ... and human gDNA (Promega, San Luis Obispo, CA) was added to reach a total input of 3 μg/130uL for fragmentation and library prep ...