Labshake search
Citations for Promega :
301 - 350 of 1790 citations for Recombinant Human GAB1 Protein T7 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... PCR products were purified and transcribed in vitro using T7 RNA polymerase (RiboMAX system, Promega). All transcripts were translated in rabbit reticulocyte lysate (Promega ...
-
bioRxiv - Biochemistry 2022Quote: The Lep-derived constructs were assayed using the TNT T7 Quick Coupled System (#L1170, Promega). Each reaction containing 1 µL of PCR product ...
-
bioRxiv - Genetics 2022Quote: ... In vitro transcription was performed with the T7 RiboMAX™ Kit (Promega, cat. no. P1320). Transcripts were purified by phenol-choloroform extraction and isopropanol precipitation.
-
bioRxiv - Cell Biology 2022Quote: ... was generated by in vitro transcription using T7 RNA polymerase (Promega, Charbonnières-les-Bains, France) in presence of Digoxygenin-labeled nucleotides (DIG RNA Labeling Mix ...
-
bioRxiv - Biophysics 2023Quote: ... which enabled their cloning into a modified pFN18A (HaloTag®) T7 Flexi® Vector (Promega). The expression cassette contained ...
-
bioRxiv - Systems Biology 2023Quote: ... genes were cloned in pFN19A (HaloTag®7) T7 SP6 Flexi® vector (Promega, USA) by Gibson assembly (Gibson et al. ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... In vitro transcription was performed with T7 RiboMAX Express Large Scale RNA Production System (Promega) according to manufacturer protocols ...
-
bioRxiv - Molecular Biology 2023Quote: FLAG-tagged SPUD in vitro expression was done with Transcend Non-Radioactive Translation Detection System (Promega) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: lrl 1μg of N-terminally FLAG-tagged receptor and 1μg of F22 (Promega, Cat. no: E2301) (for GloSensor assay)
-
bioRxiv - Immunology 2022Quote: ... 40% glycerol and 0.4 U/μl recombinant RNase inhibitor (Promega, Cat# N2615) and then incubated at room temperature for 10 min ...
-
bioRxiv - Biophysics 2022Quote: ... was in vitro transcribed and translated with a reticulocyte lysate system TnT T7 (Promega, Fitchburg, WI) by incubation of plasmid DNA (1 mg ...
-
bioRxiv - Developmental Biology 2021Quote: ... mRNA was synthesized using RiboMAX™ Large Scale RNA Production Systems-T7 (Promega, Madison, WI, USA). For efficient translation of the fusion proteins in embryos ...
-
bioRxiv - Cell Biology 2021Quote: Substrate RNAs were synthesized by in vitro transcription using a T7 RNA production system (Promega, P1300) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: A 1000 nucleotide transcript was transcribed using the Ribo-probe Combination System--SP6/T7 RN (Promega), according to the manufactures instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the sense and antisense probes were in vitro transcribed with T7 RNA Polymerase (Promega, P2075).
-
bioRxiv - Molecular Biology 2019Quote: ... The corresponding RNAs were produced with the T7 RiboMAX Express large scale RNA production system (Promega) and purified by denaturing PAGE ...
-
bioRxiv - Molecular Biology 2020Quote: ... hepatica calmodulin 2 (fhcam2, AM412547) were generated using the T7 RiboMAX™ Express RNAi System (Promega) with primers listed in Supplementary Table 2 ...
-
bioRxiv - Genetics 2019Quote: ... Digoxigenin-labeled probes were then synthesized using in vitro transcription (T7 RNA Polymerase, Promega / Life Technologies), ethanol precipitated ...
-
bioRxiv - Microbiology 2021Quote: ... The pTM plasmids were transfected into H7-T7-IZ cells using ViaFect™ Transfection Reagent (Promega) following the manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2021Quote: ... Different kinds of dsRNA were subsequently generated with the T7 RiboMAX™ Express RNAi System (Promega). Delivery of dsRNA was performed with a Nanoject II micro-injector (Drummond Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... and 250 ng were processed by in vitro transcription using the HiScribe T7 kit (Promega, E2040S) and incubated at 37 °C overnight ...
-
bioRxiv - Bioengineering 2021Quote: PCR products containing the trigger T7 transcriptional unit were cleaned by PCR cleanup kit (Promega, A6754) and 250 ng were processed by in vitro transcription using the HiScribe T7 kit (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... In vitro transcription was performed using the T7 RiboMAX Express Large Scale RNA Production System (Promega), followed by Lithium Chloride precipitation to purify the synthesized RNA.
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was carried out in T7 RiboMAX Large Scale RNA Production System kit (Promega) according to manufacturer instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The digoxigenin-labeled antisense cRNA probe was synthesized by in vitro transcription with T7 polymerase (Promega), RNA labeling mix (Roche) ...
-
bioRxiv - Plant Biology 2023Quote: ... LSH3 and LSH4 were transcribed from pGEM®-T Easy with T7/SP6 RNA polymerase (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... dsRNA was synthesized using a commercial kit (T7 RiboMAX Express RNAi System, Promega, Madison, WI, USA) and purified by phenol ...
-
bioRxiv - Bioengineering 2024Quote: dsRNA was synthesized with the T7 RiboMAX™ Express RNAi System (Promega Corporation, Madison, WI, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Digoxigenin-labeled probes were then synthesized using in vitro transcription (T7 RNA Polymerase, Promega / Life Technologies), ethanol precipitated ...
-
bioRxiv - Neuroscience 2020Quote: ... All designed probes were tested by ddPCR using human genomic DNA (Human male, Promega) as a negative control ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human Genomic DNA (G1521, Promega) was used as positive control and synthetic DNA was used to validate the LAMP assay performance ...
-
bioRxiv - Molecular Biology 2021Quote: ... and recombinant plasmids were isolated using the Pure Yield Plasmid Miniprep System (Promega). Sizes of purified plasmids were verified by agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2022Quote: ... ~2.5 μg recombinant bacmid DNA and 3 μl FuGENE HD Transfection reagent (Promega) in 100 μl Sf900 II media (Invitrogen ...
-
bioRxiv - Physiology 2020Quote: ... using recombinant active SGK1 as a positive control following the manufacturer’s instructions (Promega). The kinase and ATPase reactions of SGK1 were carried out at 30°C for 1 hr using 400 μM ATP and a designed peptide (Murray et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant RNasin ribonuclease inhibitor (1 uL/ml; Promega, Madison, WI; Cat#N2511). These washes were followed by an additional wash with 500 μl each of both wash buffer and high salt wash buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant RNasin ribonuclease inhibitor (1 ul/ml; Promega, Madison, WI; Cat#N2511) with a mechanical homogenizer followed by addition of TURBO DNase (2 μl ...
-
bioRxiv - Genomics 2022Quote: ... Recombinant bacmid DNA was isolated using the SV genomic DNA isolation kit (Promega) using manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: Ni-NTA beads were firstly digested with 500 ng recombinant Lys-C (Promega) at RT while shaking at 1,400 rpm ...
-
bioRxiv - Microbiology 2021Quote: ... The in vitro transcribed RNA was synthesized using T7 RiboMAX Express Large Scale RNA production system (Promega) and purified by phenol/chloroform extraction and two successive precipitations with isopropanol and ethanol ...
-
bioRxiv - Developmental Biology 2019Quote: Digoxigenin (DIG) and fluorescein (FLU)-labelled RNA probes were synthesized using T7 or T3 RNA polymerases (Promega) according to manufacturers’ instructions and supplied with DIG or FLU labelled UTP (Roche) ...
-
bioRxiv - Immunology 2019Quote: In vitro transcribed (IVT) RNAs were generated using T7 RiboMAX express large-scale RNA production system (Promega), using oligoDNA containing the sequence of interest behind a T7 promoter ...
-
bioRxiv - Molecular Biology 2021Quote: ... The NanoLuc mRNA was in vitro transcribed (T7 RiboMAX Express Large Scale RNA Production System, Promega, USA) from a template containing β-globin 5’-UTR ...
-
bioRxiv - Cell Biology 2021Quote: ... the dsRNAs were synthesized from the products using T3 and T7 RNA polymerases (Promega, P2075, and P2083). The transcription products were incubated at 70 °C for 10 min and at 37 °C for 30 min for annealing ...
-
bioRxiv - Neuroscience 2020Quote: ... the sense robo2 probe was synthesized from pBlueScript-robo2 linearized with XhoI using T7 RNA polymerase (Promega). Probes were hydrolyzed in 0.6M sodium carbonate and 0.4M sodium bicarbonate at 60°C for 11min to yield 300-500bp fragments ...
-
bioRxiv - Biochemistry 2021Quote: ... (56)) were prepared and purified using the T7 RiboMAX™ Express Large Scale RNA Production System (Promega). The DNA templates (T7crRNA 5’-CCCACATGGCATTCCACTTATCACATCTACAACAGTAGAAATTACCCTATAGTGAGTC GTATTATCGATC-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... Purified PCR products were transcribed in vitro using the RiboMAX Large Scale RNA Production System-T7 (Promega) at 37°C for 4 h ...
-
bioRxiv - Biochemistry 2019Quote: In vitro transcription reactions were carried out using T7 RiboMAX™ Large Scale RNA Production System (Promega) in 10 µl volumes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 700 ng used for in vitro transcription/translation using TnT T7 Quick for PCR DNA (Promega) and the Fluorotect GreenLys tRNA (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... Capped cRNAs were transcribed in vitro using the RiboMAX™ Large Scale RNA Production System-T7 (Promega) from plasmid DNA templates linearized with NheI ...
-
bioRxiv - Microbiology 2021Quote: ... Eukaryotic in vitro Nluc expression was performed with TnT-T7 Quick Coupled Transcription/Translation System (# L1170, Promega) with 100 ng of pT7CFE1-NLuc plasmid DNA ...