Labshake search
Citations for Promega :
301 - 350 of 3021 citations for Recombinant Human Endothelin Converting Enzyme 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µg of RNA was subjected to reverse transcription using M-MLV enzyme (Promega #M1705), dNTP mix 100 mM each (BLIRT #RP65 ...
-
bioRxiv - Microbiology 2020Quote: ... Restriction enzymes were obtained either from New England Biolabs (UK) Ltd or from Promega (UK). The EnzChek Phosphate assay kit and Pierce BCA Protein assay kits were purchased from Life Technologies (USA) ...
-
bioRxiv - Cancer Biology 2021Quote: We performed reverse transcription using the reverse transcriptase enzyme ImPromII (Promega Co., Fitchburg, WI, USA) from 1 μg of total RNA ...
-
bioRxiv - Pathology 2021Quote: ... All results were normalized according to the co-transfected Renilla luciferase enzyme activity (E1910, Promega).
-
bioRxiv - Evolutionary Biology 2022Quote: ... primers (0.4μM) and 0.75U of Go Taq® DNA polymerase enzyme (Promega Madison, Wisconsin, USA) with its buffer (1x) ...
-
bioRxiv - Microbiology 2021Quote: ... restriction enzymes and polymerase were used as recommended by manufacturers (Promega and New England Biolabs). Plasmids were verified by PCR and Sanger sequencing (Eurofins) ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was reverse transcribed into cDNA using random hexanucleotide primers and M-MLV enzyme (Promega). ChIP experiments were performed using 20μg anti-ΔNp63 (Biolegend ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was reverse transcribed into cDNA using random hexanucleotide primers and M-MLV enzyme (Promega). Quantitative RT-PCR was performed with SYBR Green mix (ABgene ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids pKHNH6 and pKHNH3 were linearised prior to transformation using restriction enzymes EcoRV (Promega, USA) and KpnI (Fisher ...
-
bioRxiv - Biochemistry 2019Quote: ... Dimeric constructs are based on VY208 and were created by artificially dimerization through an N-terminal GST-tag (Reck-Peterson et al, 2006) and tagged with a HaloTag (Promega) at the C-terminus as well as a GFP at the very N-terminus ...
-
bioRxiv - Biophysics 2019Quote: ... the same DNA was combined with a PCR fragment amplified from cZP1full/pGEM57 to generate a 6His-tagged full-length cZP1 ORF in pSI (Promega). The pHLsec3 construct expressing C-terminally 6His-tagged mZP1-N1M1-A141 was generated by PCR ...
-
bioRxiv - Cell Biology 2021Quote: ... and Flag-tagged HGF WT and HGF 4Cys-4Ala were in-vitro translated (TNT quick coupled Transcription/Translation system, Promega) and were incubated with the bead bound c-MET for 4h at 4 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293 cells were co-transfected with FLAG-tagged receptor constructs and luciferase-based 22F cAMP biosensor (Promega, Cat. no. E2301) using polyethylenimine (PEI ...
-
bioRxiv - Biochemistry 2021Quote: ... Halo-tagged ubiquitin-binding domains (UBDs) of TUBE (tandem-repeated ubiquitin-binding entities) was incubated with HaloLink resin (200 μL, Promega) in binding buffer (50 mm Tris⍰HCl ...
-
bioRxiv - Genomics 2020Quote: ... HCT116 Tet-OsTIR1 Scc1-mAID-Halo cells were fluorescently tagged by incubating with 50 nM HaloTag diAcFAM (Promega, cat# G8272) or 500 nM HaloTag JF488 for 30 min ...
-
bioRxiv - Synthetic Biology 2021Quote: Absolute protein concentration of HiBiT-tagged proteins was measured using the Nano-Glo® HiBiT Extracellular Detection System N2420 (Promega). CFPS reactions were diluted 104-106 -fold using 1X PLB+PI buffer (generated by mixing 2 mL of 5x Passive Lysis Buffer E1941 (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... 200 ng of DNase treated RNA library was added to 100 nM of Halo-tagged proteins immobilized onto magnetic resin (Promega). The volume of each binding reaction was 100µl in SEQRS buffer containing 200 ng yeast tRNA competitor and 0.1 units of RNase inhibitor (Promega) ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transfected with empty pRK5 vector or pRK5 expressing HA-UB (HA-tagged ubiquitin) by using Fugene 6 (Promega), as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: Myc- and FLAG-tagged versions of the different ALOG proteins were produced using the Quick Coupled Transcription/Translation System (TnT; Promega). 25 µL of TnT reactions producing indicated proteins were mixed with Buffer 1 to reach 150 µL and rotated at 4 °C during 1 h ...
-
bioRxiv - Neuroscience 2023Quote: Surface expression was measured using a HiBit-tagged 5-HT2A receptor and the Nano-Glo HiBit Extracellular Detection System (Promega). N-terminal HiBit-tagged human 5-HT2A receptor was cloned into pcDNA3.1 using Gibson Assembly ...
-
bioRxiv - Biochemistry 2022Quote: ... COS-7 cells were individually transfected with mCherry or mCherry-tagged Homer1 (WT, R3E and R3E-ENAH) by ViaFect Transfection Reagent (Promega). Briefly ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were grown to 80% confluency prior to transfection with the indicated FLAG tagged ISG15 pcDNA5 plasmids using the FuGene transfection reagent (Promega). After 24 hr ...
-
bioRxiv - Neuroscience 2023Quote: ... extracellular and intracellular assays were performed to determine levels of HiBiT-tagged F3 using either the Nano-Glo HiBiT Extracellular Detection System or the Nano-Glo HiBiT Lytic Detection System (Promega). For the extracellular HiBiT protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... HEK293T cells were transfected with 3.5μg of N-terminally FLAG-tagged receptor and 3.5μg of an SRE-based luciferase reporter plasmid pGL4.33 (Promega, Cat. no: E1340). 14-16h after transfection ...
-
bioRxiv - Immunology 2023Quote: ... Double stranded RNA (dsRNA) was synthesized from purified T7-tagged PCR amplicons using the T7 RiboMax Express Large-Scale RNA production system (Promega) according to the manufacturer’s instructions and purified as previously described [33] ...
-
bioRxiv - Microbiology 2020Quote: Recombinant TgGat1 (0.625-2.5 µM) was incubated with a given UDP-sugar (50 µM) (Promega) in 50 mM HEPES-NaOH (pH 7.4) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... QuantiLum Recombinant Luciferase and the BrightGlo Luciferase Assay System were acquired from Promega (Madison, WI). The HIV-1 inhibitor temsavir was acquired from ViiV Healthcare (Brentford ...
-
bioRxiv - Microbiology 2021Quote: ... recombinant TgPDEs or immunoprecipitated TgPDEs were assayed using the PDE-Glo Phosphodiesterase Assay kit (Promega) according to the manufacturer’s instructions with a few modifications ...
-
bioRxiv - Systems Biology 2019Quote: Cells were lysed and recombinant proteins were isolated using Magne® HaloTag® Beads (Promega) as previously described (15) ...
-
bioRxiv - Immunology 2020Quote: ... Mice were tested individually in duplicates by stimulation with recombinant luciferase (13μg/ml, Promega, #E1701), SARS-CoV-2 spike protein (10μg/ml) ...
-
bioRxiv - Plant Biology 2023Quote: ... in the presence of 20 units of RNasin (Recombinant Ribonuclease Inhibitor, Cat. No. C2511; Promega) and dNTP mix at a final concentration of 0.5 mM of each dNTP (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... all the steps were done in the presence of RNase inhibitor (recombinant RNasein, Promega, N2511) diluted 1:4,000 for washing steps or 1:400 for incubation while staining and for buffers in the tubes containing the sorted cells followed by snap freeze and storage at –80°C.
-
bioRxiv - Biochemistry 2023Quote: ... 10 μg of the isolated recombinant bacmid and 5 μL Fugene HD transfection reagent (Promega) were diluted in 150 μL Sf-900™ III SFM ...
-
bioRxiv - Biochemistry 2020Quote: ... This strain (BL21DE3/pETDuet-1-6xhis-TEV-ftsE) was grown until OD600 of 0.5 and his-FtsE expression was induced with 0.3 mM IPTG (Promega) during 3 hours at 28°C ...
-
bioRxiv - Cell Biology 2020Quote: ... The complete Igκ-LaNt α31-Myc-His sequence was inserted into pGEM®-5Zf(+) vector (Promega, Madison, WI) using NheI and PmeI (New England Biolabs) ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Promega, Madison, WI, USA) was diluted to 10,000 genome copies per μl then serially diluted to 10 genome copies per μl and used to create a human DNA copy number standard curve ...
-
bioRxiv - Molecular Biology 2019Quote: ... The natural templates include purified human (Promega), rhesus monkey (BioChain) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human Genomic DNA Male (Promega, cat # G1471) and IDH1 R132H Reference Standard (Horizon ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50ng of normal human genomic DNA (Promega) was used as a negative control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human LAMA1 cDNA was purchased from Promega and sub-cloned into pLVX-Tet-On Advanced vector (Clontech) ...
-
bioRxiv - Genomics 2021Quote: Commercial human DNA (Promega, Cat. No. G1521) was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... These included 5μg/ml human gDNA (Promega), 500ng/ml citrullinated histones (Cayman Chemical #501620) ...
-
bioRxiv - Microbiology 2023Quote: ... Human gDNA (Promega, San Luis Obispo, CA) was added to the extracted gDNA from the clinical swabs to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2024Quote: ... a K562 human peptide digest standard (Promega) and E.coli peptide standard (Waters ...
-
bioRxiv - Genomics 2023Quote: ... Human male genomic DNA (Promega, CAT #G1471) was used for a standard curve at 125 pg/µL ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...