Labshake search
Citations for Promega :
51 - 100 of 5708 citations for Rat Vasoactive Intestinal Polypeptide Receptor 1 VIPR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... ELISA plates were immediately read using a GloMax®-Multi Detection System microplate reader (Promega) at 450nm absorbance.
-
bioRxiv - Microbiology 2022Quote: ... caspase-1 activity was measured using the Caspase-Glo 1 Inflammasome Assay kit (Promega) per manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... ExpiCHO cells then were incubated with Jurkat cells expressing FcγRIIIa receptor or FcγRIIa on their surface and stably transfected with NFAT-driven luciferase gene (Promega, Cat. Nr.: G9798 and G7018) at an effector to target ratio of 6:1 for FcγRIIIa and 5:1 for FcγRIIa ...
-
bioRxiv - Biophysics 2020Quote: ... The construct expresses rat GR fused with HaloTag protein (Promega, Madison, WI, USA) in the C-terminal domain under the CMVd1 promoter ...
-
bioRxiv - Immunology 2023Quote: Activation of chemokine receptors was detected by measuring ß-galactosidase activity using the commercially available Beta-Glo assay system (Promega Corp, Madison, WI, USA) and luminescence signal was recorded on a multimodal plate reader (Enspire 2300 ...
-
bioRxiv - Molecular Biology 2023Quote: ... These cells were transfected in 70% confluent 6-wells TC-treated plates with 2 µg TGFβ receptor-Nanoluciferase constructs (constructs were provided by Promega and Promega R&D) using a 1 µg DNA ...
-
bioRxiv - Systems Biology 2019Quote: Caspase 1 activity was measured using commercially available kit (Caspase 1 Glo inflammasome assay, Promega). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... ELISA was performed on the homogenate using the BDNF Emax Immuno Assay Systems (Promega KK, Tokyo, Japan). The hippocampus (HPC ...
-
bioRxiv - Immunology 2023Quote: ... ELISA plates were immediately read using a GloMax®-Multi Detection System microplate reader (Promega, Madison WI) at 450 nm absorbance.
-
bioRxiv - Cell Biology 2019Quote: ... Cell signalling) or rabbit anti-TgTOM40 (1:2000, (van Dooren et al., 2016)) antibodies coupled to secondary horseradish peroxidase (HRP)(Promega for mouse and rabbit, Abcam for rat) conjugated antibodies (1:10,000 ...
-
bioRxiv - Immunology 2022Quote: Caspase-1 activity was quantified using a Caspase-Glo 1 Inflammasome Assay kit (Promega, Madison, WI). THP-1 cells were treated and harvested as described above ...
-
bioRxiv - Molecular Biology 2021Quote: ... Rat Gβ1 was cloned with a C-terminal SmBiT34 (peptide 86 or HiBiT, Promega) connected with a 15AA polypeptide linker ...
-
bioRxiv - Biophysics 2022Quote: The pHaloTag-GR plasmid expresses rat GR fused to HaloTag (Promega, Madison, WI, USA) in the C-terminus regulated by a CMVd1 promoter and has been described previously (57) ...
-
bioRxiv - Cell Biology 2019Quote: ... ELISA data was normalized to viable cell number determined by MTT assay (Boehringer Ingelheim) or CellTiter-Blue (Promega). IFN levels were determined using a HEK293T IFN reporter cell line (clone 3C11 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μg RNA was reverse transcribed using Reverse Transcription Kit (Promega) with oligo(dT ...
-
bioRxiv - Microbiology 2020Quote: ... Rabbit and rat primary antibodies were detected with horseradish peroxidase (HRP) conjugated anti-rabbit (Promega) and anti-rat (Jackson ImmunoResearch ...
-
bioRxiv - Cancer Biology 2020Quote: ... rat C/EBP□-LIP or -LAP containing pcDNA3 or pSV2Zeo vector by using FugeneHD (Promega) according to the manufactures protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... Tissue supernatant were used to estimate BDNF (detection limits 7.8-500 pg/ml) by ELISA (BDNF Emax Immuno Assay System, #G7611, Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR reactions using the GoTaq 1-Step RT-qPCR kit (Promega) were set-up to 10 µl final reaction volumes according to the manufacturer’s instructions containing 250 nM of each receptors primer pairs and 10 ng of RNA ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were either treated with 50ng/ml rat Nerve Growth Factor (NG; Promega, Madison, WI, USA) at 0 ...
-
bioRxiv - Bioengineering 2022Quote: ... was performed to measure the specific killing activity of anti-HIV CAR-T cells toward LHL2/3 cells and LEL6 cells at different ratios from 1:1 to 10:1 by using the CytoTox 96 non-radioactive cytotoxicity kit (Promega, Madison, WI, United States) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: Senescence was measured using 2 assays: 1/ Beta-Glo Assay kit (Promega # E4720), according to the manufacturer’s instructions and utilizing a luciferin-galactoside substrate (6-O-β galactopyranosylluciferin) ...
-
bioRxiv - Neuroscience 2019Quote: CHO-K1 cells (ATCC, cultured as described above) were transfected with rat TRAAK-GFP with FugeneHD (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... luciferase assay reagent was mixed in a 1:1 ratio with cell lysate (Luciferase Assay System kit, Promega, Madison, WI). Luciferase activity was measured with Synergy H4 Hybrid Reader (BioTek ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 μg cellular RNA was treated with DNase (RQ1 Rnase-Free DNase kit Promega) and reverse-transcribed following the GoScript ™ Reverse Transcriptase Kit (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... and the 200 nM GoTaq® Probe 1-Step RT-qPCR System Kit (Promega). This kit uses GoTaq Probe qPCR Master Mix with dUTP (10 uL) ...
-
bioRxiv - Systems Biology 2024Quote: ... coagulans DSM 1 = ATCC 7050 was extracted using Wizard Genomic DNA Purification Kit (Promega) according to the protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... washed with PBS and inflammasome activation was assessed using qPCR or inflammasome caspase-1 activity was measured using Caspase-Glo® 1 inflammasome assay kit (G9951; Promega) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... Rat Gβ1 with an N-terminal MHHHHHHSSGLVPRGSHMASHHHHHHHHHH-tag (His16) was fused with the SmBiT subunit (peptide 86, Promega)20 via a 15 amino acid (GSSGGGGSGGGGSSG ...
-
bioRxiv - Cancer Biology 2023Quote: ... viable cells were quantified in a FLUOstar OPTIMA ELISA reader (550/590 nm) about 2 h after CellTiter-Blue staining (Promega, Cat No. G8081). Mean values +/-standard deviations (SD ...
-
bioRxiv - Immunology 2020Quote: ... and cDNA synthesized from 1 µg total RNA (High Capacity cDNA Reverse Transcription Kit, Promega). Quantitative RT-PCR was performed using FluoCycle II SYBR Master Mix (EuroClone ...
-
bioRxiv - Neuroscience 2024Quote: ... using BRYT Green Dye contained in the GoTaq 1-Step RT-qPCR kit (Promega: A6020) in the CFX96 Touch Real-Time PCR Detection system (Bio-Rad) ...
-
bioRxiv - Neuroscience 2019Quote: ... The U6 reporter construct was assembled by ligating a 663bp rat U6 sequence into the HindIII and NheI sites of the pGL4.23 vector (Promega) upsteam of the minimal promoter in this vector ...
-
bioRxiv - Cancer Biology 2019Quote: ... rat or cynomolgus ICOS as target cells were co-incubated with ADCC reporter cells expressing human FcγRIIIa (V158; Promega) at a 5:1 ratio ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Total DNA was isolated from 1 ml culture using the Wizard Genomic DNA Purification Kit (Promega). Concentration and quality of the extracted DNA was assessed using the NanoDrop™ (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 µg of RNA was used to create cDNA with the ImpromII Reverse Transcriptase Kit (Promega) following the manufactures standard protocol including oligodT oligos and 4.8 M MgCl2 in each 20 µl reaction (Promega) ...
-
bioRxiv - Developmental Biology 2022Quote: ... first-strand cDNA was synthesized using 1 µg total RNA with MMLV Reverse Transcription Kit (Promega) and poly-T primer ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified by real-time RT-qPCR (GoTaq 1 step RT-qPCR kit, Promega). Quantification was provided by serial dilutions of an appropriate T7-generated synthetic RNA standard ...
-
bioRxiv - Microbiology 2022Quote: Viral RNA was quantified by real-time RT-qPCR (GoTaq 1 step RT-qPCR kit, Promega). Quantification was provided by serial dilutions of an appropriate T7-generated synthetic RNA standard ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative Realtime PCR (qRT-PCR) was performed using GoTaq® 1-Step RT-qPCR kit (Promega) with primers specific for PEX1 (RE7039-RE7040 ...
-
bioRxiv - Microbiology 2023Quote: ... viral RNA was quantified by real-time RT-qPCR (GoTaq 1 step RT-qPCR kit, Promega). Quantification was provided by serial dilutions of an appropriate RNA standard ...
-
bioRxiv - Zoology 2024Quote: One-step RT-qPCR was conducted using GoTaq 1-Step RT-qPCR System kit (Promega, France) in total reaction volume of 20 µl containing 2 µl of RNA extracts and 300 nM of the same forward and reverse primers as above ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCR was performed using the GoTaq 1-Step RT-qPCR kit (Promega Cat. No. A6020) using nifH and 16S rRNA (reference gene ...
-
bioRxiv - Microbiology 2023Quote: ... Complimentary DNA was prepared from 1 µg of RNA using a Reverse Transcription Systems Kit (Promega). Quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA was quantified by real-time RT-qPCR (GoTaq 1 step RT-qPCR kit, Promega). Quantification was provided by serial dilutions of an appropriate T7-generated synthetic RNA standard ...
-
bioRxiv - Neuroscience 2021Quote: ... of miR-3594-5p was amplified from rat brain cDNA and cloned downstream of the Renilla luciferase reporter gene into the psiCHECK-2 vector (Promega).
-
bioRxiv - Evolutionary Biology 2020Quote: ... and the orthologous 208 bp blind mole rat sequence (nanGal1 assembly; KL203377:255659-255866) into a luciferase pGL4.23[luc2/minP] vector (Promega, US). We cloned the insert in the same orientation with respect to the minP promoter and luciferase gene as the CNE and the Tdrd7 promoter are oriented in the genome ...
-
bioRxiv - Biochemistry 2022Quote: ... The half site ARE reporter is derived from the minimal rat probasin sequence (Zhang et al., 2000) and was cloned into pGL3 via KpnI and NcoI restriction sites (Promega). pRL-TK (Promega ...