Labshake search
Citations for Promega :
51 - 100 of 4069 citations for Rat TGF beta 2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... LacZ reporter activity was assayed in defined media (SD) supplemented with -Leu-Trp using the Beta-Glow® Assay System following commercially available protocols (Promega #E4720). In short ...
-
bioRxiv - Plant Biology 2020Quote: ... genomic DNA was extracted from 2-wk old seedlings using the Wizard Genomic DNA purification kit (Promega) and was subjected to PCR analysis using two AtNIP2;1 gene specific primers and the left border T-DNA primer (all primers used in this study are described in Supplemental Table 1) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was synthesised from 2 μg RNA using the GoScriptTM Reverse Transcription kit (Promega, UK, Cat. A5003). Primers were designed using NCBI BLAST primer design or ...
-
bioRxiv - Developmental Biology 2019Quote: ... We measured LacZ reporter activity using the Beta-Glo® Assay System following the commercially available protocols and the yeast literature (Promega, Madison, WI) (Hook ...
-
bioRxiv - Cell Biology 2021Quote: ... confirmed by positive beta-galactosidase staining and decreased proliferation rate (31) were transfected with peflin siRNA using Transfast (Promega Corp., Madison WI, USA) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... The construct expresses rat GR fused with HaloTag protein (Promega, Madison, WI, USA) in the C-terminal domain under the CMVd1 promoter ...
-
bioRxiv - Neuroscience 2021Quote: ... ELISA was performed on the homogenate using the BDNF Emax Immuno Assay Systems (Promega KK, Tokyo, Japan). The hippocampus (HPC ...
-
bioRxiv - Immunology 2023Quote: ... ELISA plates were immediately read using a GloMax®-Multi Detection System microplate reader (Promega, Madison WI) at 450 nm absorbance.
-
bioRxiv - Immunology 2023Quote: Activation of chemokine receptors was detected by measuring ß-galactosidase activity using the commercially available Beta-Glo assay system (Promega Corp, Madison, WI, USA) and luminescence signal was recorded on a multimodal plate reader (Enspire 2300 ...
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA (2 µg) was reverse transcribed into cDNA using a cDNA synthesis kit (Promega, Madison, WI, USA). The RT-PCR was assessed using r-Taq plus Master Mix (Elpis Biotech ...
-
bioRxiv - Microbiology 2019Quote: DENV-2 viral RNA was extracted from sera using the Viral Total Nucleic Acid Kit (Promega, Madison, WI) on a Maxwell 48 RSC instrument (Promega ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 ug of RNA were reverse transcribed using a reverse transcription kit (GoScript™ Reverse Transcription System, Promega). The abundance of specific transcript was measured by probing 1 μL cDNA by quantitative real-time PCR in a total volume of 10 µl containg 5 μL SYBR-green master mix (Roche) ...
-
bioRxiv - Bioengineering 2022Quote: ... Uptake of 2-deoxyglucose by the adipocytes was measured using a Glucose Uptake-Glo™ Assay kit (Promega) and luminescence was measured according to the manufacturer’s instructions using a plate reader ...
-
bioRxiv - Biochemistry 2022Quote: ... genomic DNA was extracted from 2-wk old seedlings by using the Wizard Genomic DNA purification kit (Promega) and was subjected to PCR analysis by using a primer set consisting of a specific CaM35S promoter sequence and a gene-specific primer (Table S1) ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μg of RNA were reverse transcribed using a reverse transcription kit (GoScript™ Reverse Transcription System, Promega). The abundance of specific transcript was measured by probing 1 μL cDNA by quantitative real-time PCR in a total volume of 10 μl containg 5 μL SYBR-green master mix (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Rat Gβ1 was cloned with a C-terminal SmBiT34 (peptide 86 or HiBiT, Promega) connected with a 15AA polypeptide linker ...
-
bioRxiv - Biophysics 2022Quote: The pHaloTag-GR plasmid expresses rat GR fused to HaloTag (Promega, Madison, WI, USA) in the C-terminus regulated by a CMVd1 promoter and has been described previously (57) ...
-
bioRxiv - Cell Biology 2019Quote: ... ELISA data was normalized to viable cell number determined by MTT assay (Boehringer Ingelheim) or CellTiter-Blue (Promega). IFN levels were determined using a HEK293T IFN reporter cell line (clone 3C11 ...
-
bioRxiv - Physiology 2023Quote: ... GLP-1 was detected by indirect sandwich amide chemiluminescence ELISA using a luminescence plate reader (GloMax Promega, USA). This total GLP-1 assay detects GLP-1 (7-36 ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were lysed after 72 h (2+1 DIV for differentiations) using the Dual Luciferase Reporter kit (Promega, E1960) and luciferase activity was measured using a Victor3 (Perkin Elmer ...
-
bioRxiv - Cell Biology 2021Quote: ... and a total amount of 2 μg RNA was reverse transcribed with a GO Script Reverse Transcriptase kit (Promega) using random primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.5 ml (approximately 2 × 109 cells) were used for gDNA extraction with the Wizard Genomic DNA Purification kit (Promega), which typically yielded 50 μl of 0.5-1.5 μg/μl gDNA.
-
bioRxiv - Physiology 2020Quote: ... Blocked membranes were incubated for 2 hours with DNA probe synthesized using a Prime-a-Gene® kit (Promega) and washed in mild and stringent Southern wash buffers ...
-
bioRxiv - Microbiology 2021Quote: ... 2) Thermolysin (Promega) or 3 ...
-
bioRxiv - Microbiology 2021Quote: ... (2) Trypsin (Promega), 4 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Erk1/2 (Promega), phospho-Erk1/2 (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... Rabbit and rat primary antibodies were detected with horseradish peroxidase (HRP) conjugated anti-rabbit (Promega) and anti-rat (Jackson ImmunoResearch ...
-
bioRxiv - Cancer Biology 2020Quote: ... rat C/EBP□-LIP or -LAP containing pcDNA3 or pSV2Zeo vector by using FugeneHD (Promega) according to the manufactures protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... Tissue supernatant were used to estimate BDNF (detection limits 7.8-500 pg/ml) by ELISA (BDNF Emax Immuno Assay System, #G7611, Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Glucose uptake was measured based on the detection of 2-deoxyglucose-6-phosphate uptake by a commercially available luminescence-based kit (Glucose Uptake-GloTM Assay, Promega) on a SpectraMax M3 (Molecular Devices) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and from the interior tissue (at least 2 mm away from the outermost edge of the specimen) using the Wizard Genomic DNA Purification Kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Approximately 5 × 107 control cells and 2 × 107 sort3 PIGS-KO HEK293 cells were used for genomic DNA extraction by Wizard Genomic DNA Purification Kit (Promega). Approximately 325 µg of genomic DNA from control cells and 30 µg of genomic DNA from sort3 cells were used for amplification of gRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was purified from 2 × 106 HCT116 cells harvested 48 hr following reporter transfection using the SimplyRNA cells kit and Maxwell RSC instrument (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: Approximately 6 × 107 control cells and 2 × 107 sort2 cells were used for genomic DNA extraction by Wizard Genomic DNA Purification Kit (A1125, Promega). Approximately 325 μg of genomic DNA from control cells and 60 μg of genomic DNA from sort2 cells were used for amplification of gRNA ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the GoTaq 1-step qRt-PCR kit (Promega) using 3.8µL of extracted RNA and 6.2µL of RT-qPCR mix that contains 250nM of each primer and 75nM of probe ...
-
bioRxiv - Genomics 2021Quote: ... Tris(2-carboxyethyl)phosphine (TCEP) and BCA protein assay kit were from Pierce and sequence-grade trypsin was from Promega. Rapigest and Sep-Pak C18 columns were from Waters and C18 Zip tips were from Millipore ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was then synthesized using 2 μg of mRNA and a Transcriptase first-strand cDNA synthesis kit (Promega, Madison, WI). Real-Time qPCR to detect the indicated targets was performed on a LightCycler® 480 System (Roche Life Science ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCRs were performed with MLV SU or 2-LTR primers (Table 1) using a Power SYBR green PCR kit (Promega) and the QuantStudio 5 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... Purified DNA was run on 2% agarose gel and bands corresponding to ∼150 bp were cut and purified with a Gel Purification kit (Promega). Libraries were constructed using the Nugen Ovation Ultralow Library System V2 following the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were either treated with 50ng/ml rat Nerve Growth Factor (NG; Promega, Madison, WI, USA) at 0 ...
-
bioRxiv - Neuroscience 2021Quote: ... Culture media was then replaced with 50 µL of qNSC/aNSC media containing 1 mM 2DG (2-deoxy-D-Glucose, provided in Glucose Uptake-Glo kit from Promega (J1342)) reagent for 10 minutes in incubator (humidified ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... equal amount of RNA (2 μg) from each sample was subjected to cDNA synthesis using reverse transcriptase Kit (Promega Corporation, USA) following standard procedures ...
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...