Labshake search
Citations for Promega :
201 - 250 of 4470 citations for Rat Mesoderm Specific Transcript Homolog Protein MEST ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant proteins were purified with MagneGST™ Protein Purification System (www.promega.com/protocols/; Promega, Madison, WI, USA).
-
bioRxiv - Plant Biology 2024Quote: ... The soluble GST and His fusion proteins were purified using the MagneGST Protein Purification System (Promega, USA) or the MagneHis Protein Purification System (Promega ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant GST-OsNAC5 fusion protein was subsequently purified with the MagneGST™ Protein Purification System (Promega), following the provided protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized with primers specific for each strand separately at 50 °C (Supplemental Table S1) using the ImProm-II™ Reverse Transcription System (Promega, A3800) and subjected to qPCR with primers specific for the viral N-protein (Supplemental Table S1).
-
bioRxiv - Biochemistry 2022Quote: ... Rat Gβ1 with an N-terminal MHHHHHHSSGLVPRGSHMASHHHHHHHHHH-tag (His16) was fused with the SmBiT subunit (peptide 86, Promega)20 via a 15 amino acid (GSSGGGGSGGGGSSG ...
-
bioRxiv - Molecular Biology 2020Quote: ... The bacterial surface proteins with attached plasma proteins were released by limited proteolysis with 2 μG trypsin (Promega) /37 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR products amplified by gene-specific RT-qPCR primers listed in Supplemental Table S1 were cloned in pGEM-T Easy vector (Promega, Madison, Wisconsin, USA) prior to their sequencing ...
-
bioRxiv - Pathology 2020Quote: ... The partial sequence encoding the nucleoprotein from HPWMoV was amplified using specific primers (Table 1) from two-fold diluted cDNA with GoTaq® Flexi DNA polymerase (Promega, WI, USA) with the following reaction conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... and 30 s extension at 72 °C using the specific primers (Forward: CCACGCAACACACAGTCAAG, Reverse: GCAAGTTACTTTGCAGAGGTC) and GoTaq G2 DNA polymerase (Promega, Madison, Wisconsin, USA). Each PCR mixture (15 μl ...
-
bioRxiv - Immunology 2024Quote: ... One μg PCR product was used as the specific-template for synthesizing of dsRNA in vitro by using the T7 Ribomax Express RNAi System (Promega, Madison, WI, USA). The concentration of dsRNA was quantified at 280 nm using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific Inc.) ...
-
bioRxiv - Cancer Biology 2021Quote: ... proteins were digested with trypsin (Promega Corporation) overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were digested with 1.5μg Trypsin (Promega) at 37°C for 12 hours ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were digested overnight with trypsin (Promega) at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were first digested with chymotrypsin (Promega) (12.5 ng/µl ...
-
bioRxiv - Cell Biology 2021Quote: ... proteins were digested overnight with trypsin (Promega). The resulting peptides were labelled with the TMT sixplex isobaric mass tag ...
-
bioRxiv - Systems Biology 2020Quote: ... Proteins were then digested with trypsin (Promega) on-beads as previously detailed (66) ...
-
bioRxiv - Plant Biology 2021Quote: ... proteins were digested overnight using trypsin (Promega, Sequencing Grade Modified Trypsin ...
-
bioRxiv - Systems Biology 2022Quote: ... Proteins were then digested with trypsin (Promega) overnight at 37°C with an enzyme trypsin ratio of 1:50 ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein digestion was done with trypsin (Promega) at a 1:50 ratio and incubated for 4 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... Proteins were digested with trypsin (Promega #V5111) in 200mM HEPES buffer pH 8.5 with 2% acetonitrile (v/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... proteins were digested with either Trypsin (Promega), a combination of Trypsin and GluC (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were digested with trypsin (V5280, Promega) overnight ...
-
bioRxiv - Microbiology 2021Quote: ... For protein digestion trypsin (Promega, Walldorf, Germany) was added in an enzyme to substrate ratio of 1:100 before incubation at 37 °C for 14 h ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were first digested with trypsin (Promega) for 1 h at 37°C (sample to enzyme ratio 1:20 ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were proteolytically digested with trypsin (Promega), chymotrypsin (Promega) ...
-
bioRxiv - Immunology 2021Quote: ... Proteins were digested with trypsin (Promega®) following filter-aided sample preparation (FASP ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were digested with trypsin (V5111, Promega). Peptide concentrations were determined using PierceTM BCA Protein Assay Kit ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were digested with LysC (Promega #VA1170) at 1:30 (enzyme:protein ...
-
bioRxiv - Plant Biology 2023Quote: ... Proteins were then digested with trypsin (Promega) overnight at 37°C with an enzyme trypsin ratio of 1:50 ...
-
bioRxiv - Biochemistry 2023Quote: ... proteins were digested using trypsin (V5111, Promega) at a 1:20 (enzyme to protein ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were then digested with trypsin (Promega) - 1:100 enzyme-to- protein ratio at 37°C overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... G protein chimera (Gsx) and Glo22F (Promega) using Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... Proteins were digested using Trypsin Gold (Promega) in 100 mM HEPES pH 7.6 at 37°C overnight ...
-
bioRxiv - Systems Biology 2023Quote: ... Denatured proteins were digested with chymotrypsin (Promega) at 1:100 (enzyme:substrate(w:w) ...
-
bioRxiv - Cell Biology 2023Quote: ... proteins were digested with Trypsin (Promega, UK) overnight at 37 °C at an enzyme to protein ratio of 1:20 ...
-
bioRxiv - Plant Biology 2023Quote: ... and tryptic digestion of proteins (V5111; Promega, Madison ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins were pre-digested with LysC (Promega) for 2 h at 25 °C and digested with trypsin (Promega ...
-
bioRxiv - Plant Biology 2024Quote: ... or the MagneHis Protein Purification System (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Subsequently proteins were digested with trypsin (Promega) at 37°C for 4 h ...
-
bioRxiv - Biochemistry 2023Quote: ... and the proteins were tryptic digested (Promega) at 37°C overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... Proteins were digested with trypsin gold (Promega) at 1:50 enzyme to protein ratio in 50 mM TEAB ...
-
bioRxiv - Cancer Biology 2023Quote: ... viable cells were quantified in a FLUOstar OPTIMA ELISA reader (550/590 nm) about 2 h after CellTiter-Blue staining (Promega, Cat No. G8081). Mean values +/-standard deviations (SD ...
-
bioRxiv - Neuroscience 2019Quote: ... The U6 reporter construct was assembled by ligating a 663bp rat U6 sequence into the HindIII and NheI sites of the pGL4.23 vector (Promega) upsteam of the minimal promoter in this vector ...
-
bioRxiv - Cancer Biology 2019Quote: ... rat or cynomolgus ICOS as target cells were co-incubated with ADCC reporter cells expressing human FcγRIIIa (V158; Promega) at a 5:1 ratio ...
-
bioRxiv - Microbiology 2020Quote: The interactions between host protein and RHDV nonstructural proteins were evaluated using a CheckMate Mammalian Two-Hybrid System (Promega). The proteins expressed from the pACT vector recombinant plasmid acted as prey proteins ...
-
bioRxiv - Microbiology 2021Quote: ... Pull down of Halo-PfSR1 interacting proteins was performed using the HaloTag® Protein Purification System (Promega, cat # G1913) according to the manufacturer guidelines ...
-
bioRxiv - Microbiology 2022Quote: ... the Halo-BysR protein was expressed using the TNT SP6 Wheat Germ Protein Expression System (Promega, Fitchburg, WI, USA). The Halo Tag-BysR protein was purified using magnetic HaloTag beads (Promega ...
-
bioRxiv - Plant Biology 2023Quote: ... the PhDEF and PhGLO1 proteins were produced with the TnT SP6 High-Yield Wheat Germ Protein Expression System (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Proteins were expressed using TNT® SP6 High-Yield Wheat Germ Protein Expression System (Promega, Madison, Wisconsin, United States) with 2 µg Plasmid DNA as input ...
-
bioRxiv - Neuroscience 2021Quote: ... All animals were genotyped according to the MMRRC strain-specific primers and protocols using GoTaq Green PCR master mix (Cat. No. M712, Promega Corporation, Madison, WI, USA).