Labshake search
Citations for Promega :
201 - 250 of 6612 citations for Rat Dynamin 1 Like Protein DNM1L ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... Purified recombinant luciferase protein (Promega) was used to generate a standard curve.
-
bioRxiv - Genomics 2022Quote: ... and the LgBiT Protein (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Magne Protein G beads (Promega) were used to purify the antibodies according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... In vitro translated proteins (Promega SP6-TNT Quick rabbit reticulocyte lysate system ...
-
bioRxiv - Cancer Biology 2022Quote: ... A BCA protein assay (Promega) was used to determine protein concentration ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HiBiT control protein (#N301A, Promega) dilutions were prepared in the same medium and added (10 µl/well) ...
-
Pushed to the edge: hundreds of Myosin 10s pack into filopodia and could cause traffic jams on actinbioRxiv - Cell Biology 2023Quote: ... Halo Standard Protein (Promega, G4491) samples were prepared for final masses of 1 ng ...
-
bioRxiv - Biochemistry 2023Quote: ... with purified LgBiT Protein (Promega). Briefly ...
-
bioRxiv - Biophysics 2023Quote: ... Protein samples were trypsinized (Promega) in 40mM ammonium bicarbonate (FISHER SCIENTIFIC) ...
-
bioRxiv - Microbiology 2021Quote: ... 0.025% deoxycholate and 200 µg.mL−1 RNase A at 37°C for 20 min to lyse the cells and Protein Precipitation Solution (Promega) was added ...
-
bioRxiv - Cell Biology 2019Quote: ... the protein sample was digested by incubation with sequencing-grade modified trypsin (1/50, w/w; Promega, Madison, Wisconsin) overnight at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Alkylation was quenched by the addition of 3 mM DTT and proteins were digested overnight at 37°C with 1 μg trypsin (0.5 μg/μl; Promega). Following digestion ...
-
bioRxiv - Cell Biology 2021Quote: ... Alkylation was quenched by the addition of 3 mM DTT and proteins were digested overnight at 37°C with 1 μg trypsin (0.5 μg/μl; Promega). Following digestion ...
-
bioRxiv - Systems Biology 2023Quote: ... Samples were diluted 1:3 with 50 mM HEPES pH 8.5 and then digested by a 1:50 (trypsin to protein) ratio of sequencing grade modified trypsin (Promega) for 16 hours at 600 rpm and 25°C ...
-
bioRxiv - Cell Biology 2023Quote: ... urea was diluted to 1 M and proteins digested overnight with modified sequencing grade trypsin (Promega, Madison, WI, USA) at a 1:50 enzyme:protein ratio ...
-
bioRxiv - Microbiology 2021Quote: ... PA) and AccuMap™ low pH protein digestion kit (with trypsin and lysC) and chymotrypsin (sequencing grade) were from Promega (Madison, WI). PreScisson protease was from GenScript (Piscataway ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were either treated with 50ng/ml rat Nerve Growth Factor (NG; Promega, Madison, WI, USA) at 0 ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein samples (about 20 μg of protein) were digested with 500 ng of trypsin (Promega) and peptides were analysed by an Ekspert nanoLC 42 nanoflow system (Eksigent Technologies ...
-
bioRxiv - Bioengineering 2022Quote: ... was performed to measure the specific killing activity of anti-HIV CAR-T cells toward LHL2/3 cells and LEL6 cells at different ratios from 1:1 to 10:1 by using the CytoTox 96 non-radioactive cytotoxicity kit (Promega, Madison, WI, United States) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: Senescence was measured using 2 assays: 1/ Beta-Glo Assay kit (Promega # E4720), according to the manufacturer’s instructions and utilizing a luciferin-galactoside substrate (6-O-β galactopyranosylluciferin) ...
-
bioRxiv - Biochemistry 2021Quote: The kinase activity of the FLT3-ITD protein was measured by using ADP-Glo™ Kinase Assay Kit (Promega, Madison, Wisconsin, the US). Briefly ...
-
bioRxiv - Microbiology 2019Quote: ... SDC concentration was adjusted to 1% and 120 µg of proteins from each bacterial culture were digested by addition of trypsin (Promega) in a 1:50 (enzyme:protein ...
-
bioRxiv - Microbiology 2019Quote: Protein digestion - for samples processed with reagent 1 and 2 as well as for supernatants (proteomes) MS grade trypsin (Promega) was used at 1:1000 w/w protease:protein ...
-
bioRxiv - Bioengineering 2020Quote: ... In-solution protein digestion was carried out in a ratio of 1:25 w/w Trypsin/Lys-C (Mass Spectrometry Grade, Promega) to protein overnight at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: Pulldowns with cellular extracts were carried out as described for GFP-immunoprecipitations using 1-2 μg of GST-fused proteins bound to glutathione magnetic beads (Promega). For immunoprecipitations of recombinant proteins ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were diluted with ddH2O 1:5 and proteins were digested for 20 h at 37°C using trypsin (Trypsin Gold, Promega) at an enzyme/protein ratio of 1:50 ...
-
bioRxiv - Cell Biology 2022Quote: ... The trapped proteins were washed four times with the methanol TEAB buffer and then digested using 1 µg Trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The sample was diluted 1:7 with 0.1 M NH4HCO3 before overnight digestion of proteins with trypsin (Promega, cat#V5113) at 30°C ...
-
bioRxiv - Cell Biology 2021Quote: ... v/v) and dehydration in ACN, proteins were digested overnight at 37 °C with trypsin (1:50, w/w) (V5280, Promega). Peptides were extracted from the gel in 50% ACN/0.1% formic acid ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were digested either with trypsin in a trypsin/protein ratio of 1/50 (w/w) (Promega Cat. No. V5111) and incubated overnight at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were diluted 8x in 50 mM ammonium bicarbonate to reduce the urea concentration to 1 M and protein digestion was performed overnight at 37 C by addition of 2 µg of trypsin (Promega) per sample.
-
bioRxiv - Plant Biology 2022Quote: ... were reduced with DTT and then alkylated with iodoacetamide and digested overnight using Lys-C/Trypsin (1:50, enzyme to protein; Promega). After terminating the digestion with 1% trifluoroacetic acid ...
-
bioRxiv - Microbiology 2023Quote: ... the samples were digested by trypsin with 1/80 (w/w) trypsin/total protein ratio (Sequencing Grade Modified Trypsin, Promega) according to the manufacturer recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... packed column (now loaded with the protein sample) 20 µL of Trypsin digestion solution (1 µg MS-grade Trypsin (Promega) in 50 mM ammonium bicarbonate ...
-
bioRxiv - Cell Biology 2022Quote: Halo-3F-SOCS1 expression was induced with doxycycline overnight (1 μg/mL) and Halo-tagged protein detected by incubation with fluorescent Halo TMR ligand (10 nM; Promega) overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... Strap binding buffer was applied to precipitate proteins on quartz and proteolysis took place during 14 hrs at 37°C with 1 µg Trypsin sequencing grade (Promega). After speed-vacuum drying of eluted peptides ...
-
bioRxiv - Biochemistry 2023Quote: ... N- glycan release was achieved after digestion with PNGase F (1 U/10 µg protein at 37 °C overnight; Promega). Released N-glycans were hydrolysed with 25 µl of 100 mM ammonium acetate at pH 5 (1 h at RT) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Alkylated proteins were then cleaved using a two-step digestion: first with Endoproteinase Lys-C (ratio 1:33 enzyme: lysate, Promega) for 1 hour at 37 °C then with Trypsin (ratio 1:33 enzyme ...
-
bioRxiv - Biochemistry 2024Quote: ... at a 1:75 enzyme to protein ratio for 6 h at 30 °C and then by trypsin (V5111, Promega) (1:50 enzyme to protein ratio ...
-
bioRxiv - Cancer Biology 2024Quote: ... Denatured proteins were enzymatically digested for 14 h at 37 °C with 1 µg of sequencing-grade Trypsin (V511A, Promega). After speed-vaccum drying ...
-
bioRxiv - Neuroscience 2019Quote: CHO-K1 cells (ATCC, cultured as described above) were transfected with rat TRAAK-GFP with FugeneHD (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... luciferase assay reagent was mixed in a 1:1 ratio with cell lysate (Luciferase Assay System kit, Promega, Madison, WI). Luciferase activity was measured with Synergy H4 Hybrid Reader (BioTek ...
-
bioRxiv - Cancer Biology 2021Quote: ... The estimation of protein concentration was done using BCA protein assay (Promega #PI-23222, PI-23224). Samples were diluted using 1X sample buffer (4X stock ...
-
bioRxiv - Cancer Biology 2022Quote: ... The estimation of protein concentration was done using BCA protein assay (Promega #PI-23222, PI-23224). Samples were diluted using 1 X sample buffer (4 X stock ...
-
bioRxiv - Cell Biology 2022Quote: ... The estimation of protein concentration was done using BCA protein assay (Promega #PI-23222, PI-23224). Samples were diluted using 1X sample buffer (4X stock ...
-
bioRxiv - Plant Biology 2023Quote: ... proteins were co-expressed using TnT® SP6 High-Yield Wheat Germ Protein Expression System (Promega) as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein G magnetic beads (Promega; G7471) were washed with PBS buffer and then added to the supernatant in a 1:10 volumetric ratio ...
-
bioRxiv - Microbiology 2021Quote: ... Protein was digested by trypsin (Promega) at a ratio of 1:50 (trypsin:protein ...