Labshake search
Citations for Promega :
451 - 500 of 3891 citations for Rat Aflatoxin B1 Aldehyde Reductase Member 3 AKR7A3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... and then lung lobes were inflated with 3% (w/v) 45°C prewarmed low-melting agarose (Promega). The inflated lung lobes were immediately removed and cooled on ice for 15 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’UTR-Nogo-A-wt product was subcloned into both the pGEM-T-easy plasmid (Promega) and the pBKS plasmid (pBluescript ...
-
bioRxiv - Molecular Biology 2022Quote: ... the HIV 5’ LTR from the pNL4-3 isolate (Genbank AF324493) was cloned into pGL3-Basic (Promega) via Gibson assembly (NEB 2X HiFi ...
-
bioRxiv - Genomics 2021Quote: ... cells were transfected in a 3:1 ratio of FuGENE® HD Transfection Reagent (Promega cat # E2311) and plasmid DNA (pcDNA3.1-HMGB1P1-3xHA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nuclear pellets obtained after centrifugation at 1,500g for 3 min were lysed in Reporter lysis buffer (Promega), passed through a 21Gneedle and incubated on ice for 10 min before centrifugation at 17,000g ...
-
bioRxiv - Genetics 2020Quote: ... for 3 hours at 37°C in the presence of RNasin Ribonuclease Inhibitor (Promega #N2111, Madison, WI), and PE2 mRNA was purified with MEGAclear™ Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... plus the full-length 3□UTR of KIF18A in the psiCheck2 dual luciferase vector system (Promega, Germany) in 10:1 (plasmid DNA:luciferase vector ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were incubated for 6 h at 37°C with 3 μg Sequencing Grade Modified Trypsin (Promega). Digestion was terminated via addition of 20 μL trifluoroacetic acid (TFA) ...
-
bioRxiv - Cell Biology 2020Quote: ... bound proteins were alkylated and digested with endopeptidase Lys-C (Wako) for 3 hours and trypsin (Promega) on beads overnight at 37°C.
-
bioRxiv - Cancer Biology 2021Quote: ... cell viability and Caspase activity were detected with CellTiter-Glo 2.0 and CaspaseGlo-3/7 assay (Promega) respectively 2 days after transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... the full length of wnt4 including 3’-UTR was cloned into pGEM-T easy vector (Promega, A1360) by primers 5’-ATGTCATCGGAGTATTTGATAAGG-3’ and 5’-AGTCTTTGACACAGCATATATTTC-3’ from cDNA ...
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... Relative cell growth at day 3 was evaluated by CellTiter-Glo Luminescent Cell Viability Assay (Promega, #G7571). The concentration of inhibitor required for 50% inhibition of cell viability (IC50 ...
-
bioRxiv - Immunology 2023Quote: ... VP1-3 proteins were then bound to the S-Trap column and digested with trypsin (Promega Corporation) for 2 hrs at 47°C ...
-
bioRxiv - Cell Biology 2023Quote: ... and 500 ng of pMCB306 plasmids described above along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were adjusted to 3 mM EDTA and digested with 1.0 μg Trypsin/LysC mix (Promega #V5073) for 1 h at 37 °C ...
-
bioRxiv - Genomics 2023Quote: ... the final selection was performed by 3% agarose electrophoresis (80 V, 2 h, 1 kB Promega ladder). The selected clones were preincubated in growth medium (15 ml ...
-
bioRxiv - Immunology 2023Quote: Proteasome activity was measured in cell lysates using the Proteasome-Glo™ 3 Substrate System (Promega, G8531). Corresponding reagents for testing as chymotrypsin-like ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were adjusted to 3 mM EDTA and digested with 0.5 μg Trypsin/LysC mix (Promega #V5073) for 1h at 37°C ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were first transfected with 3′UTR luciferase constructs (10 ng) using FuGENE HD transfection reagent (Promega) for 4 hours then transfected with Dharmacon miR-199a-5p mimic (50 nM ...
-
bioRxiv - Cell Biology 2020Quote: ... caspase8 Kit (Promega company); Caspase3 / 7 Kit (Promega company).
-
bioRxiv - Molecular Biology 2020Quote: ... or Maxwell kit (Promega). Following RNA extraction ...
-
bioRxiv - Genetics 2023Quote: ... the GoScript Kit (Promega) was used to make cDNA and qRT-PCR performed on a BioRAD c1000 Touch thermocycler.
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of repair template was transfected into 200,000 cells using a 3:1 ratio Fugene6:DNA (Promega), after overnight transfection cells were grown in fresh medium for 6 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Genomics 2020Quote: ... 50000 viable cells were pelleted and lysed in Resuspension buffer (Tris-HCl pH 7.4 10 mM, NaCl 10 mM, MgCl2 3 mM, NP40 0.1%, Tween-20 0.1%, digitonin 0.01% - Promega #G9441) for 3 min on ice ...
-
bioRxiv - Genomics 2019Quote: ... Alternatively, ¼ of an agarose plug was soaked in GET solution (3% 2-mercaptoethanol, 0.5x QuantiFluor® dye (Promega), 1X TBE ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Cancer Biology 2022Quote: ... pMD2.G and the lentiviral gRNA plasmid at a 3:1:5 mass ratio using FuGENE HD (Promega) in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Microbiology 2020Quote: ... A DENV-1 3’UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: Cell viability was assayed with an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) colorimetric assay (Promega) per manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were treated with 3 µM PP242 for 2 h and lysed with Passive Lysis Buffer (Promega, E194A). Luminescence was detected with a Dual- Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with the Piggybac plasmid plus transposase at a 3:1 ratio using Fugene HD (Promega) and selected with G418 (300 µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... Elution was conducted in 3 beads volume of proteasome buffer containing 1 μL of TEV protease (Promega, PRV6101) for 1 hr at 37°C.
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Systems Biology 2024Quote: ... followed by a 3:1 dilution with 100mM ammonium bicarbonate and addition of 2µg sequence-grade trypsin (Promega). Samples were digested at room temperature overnight and acidified with formic acid (final concentration 1%) ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Microbiology 2020Quote: NCIMB8209 DNA was isolated using a commercial kit (Wizard Genomic DNA purification kit, Promega), following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... column purification kits or Maxwell 16 LEV simplyRNA Purification Kits (Promega, Madison, WI, USA) and prepared cDNA libraries using TruSeq RNA Library Prep Kit (Illumina ...
-
bioRxiv - Zoology 2022Quote: DNA was extracted with several different kits: the Wizard Genomic DNA Purification kit (Promega), the Qiagen Blood & Tissue kit ...
-
bioRxiv - Microbiology 2019Quote: The luciferase assay kit (Promega) was used to test the expression and regulation performance of the selected transactivator-positive clones ...
-
bioRxiv - Cell Biology 2020Quote: ... Caspase3 / 7 Kit (Promega company).
-
bioRxiv - Biochemistry 2020Quote: ... CellTiter-Glo 2 kit (Promega) using manufacturer’s instructions.