Labshake search
Citations for Promega :
1 - 50 of 3880 citations for QuantiChrom G6PDH Inhibitor Screening Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: Methyltransferase activity of the NSP10-NSP16 complex and inhibitor screening was performed using the MTase-Glo assay (Cat. No. V7601, Promega) (Hsiao et al ...
-
bioRxiv - Molecular Biology 2023Quote: The HDAC-Glo I/IITM screening system (Promega, cat#G6430)69 was adapted to measure the effect of compounds on the enzymatic activity of human and yeast HDACs (see Note S2) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Substrate screening was primarily conducted using the MTase-Glo Assay (Promega). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... Colony and screening PCRs were performed using GoTaq DNA polymerase (Promega; supplemented with 10% DMSO when screening B ...
-
bioRxiv - Molecular Biology 2022Quote: ... Screening of the colonies was performed by colony PCR using GoTaq Polymerase (Promega). Subsequently ...
-
bioRxiv - Molecular Biology 2023Quote: ... and PCR screening was performed using GoTaq Flexi DNA polymerase (Promega, Wisconsin, United States) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... CYP3A4 activity was analyzed by P450-Glo CYP3A4 Assay and Screening System (V9001, Promega, WI, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... the toxicity of the compounds at the screening concentration was evaluated with Cell-Titer Glo (Promega). In each well ...
-
bioRxiv - Molecular Biology 2022Quote: ... Colonies were screened by PCR screening using GoTaq G2 Hot Start green Master Mix (M7422, Promega) using the consensus pLKO F oligonucleotide (5’->3’GACTATCATATGCTTACCGT ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... The monoclonal cells with successful EGFP incorporation were identified by PCR screening using GoTaq Polymerase (Promega). The clonal SUM159 cells expressing EGFP-Rab11A+/+ were subjected to the second round of genome editing to incorporate Lamp1-Halo in the genome as described above ...
-
bioRxiv - Molecular Biology 2023Quote: ... Experiments with varied activator concentration and screening were measured using the Kinase-Glo Luminescent Kinase Assay (Promega). Reactions were incubated at 25°C for 1 hour then reduced to 4°C in a thermocycler consisting of 50nM of recombinant VCP with or without 50nM UFD1/NPLOC4 in 50uL ATPase reaction buffer (25mM HEPES ...
-
bioRxiv - Immunology 2020Quote: ... RNase inhibitors (RNasin Ribonuclease inhibitor, Promega). Cell lysates were denatured in LDS sample buffer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... the expression of CYP3A4 was quantified using P450-Glo™ Assay and Screening Systems (V9001, Promega, Madison, WI) in response to different oxygen concentrations ...
-
bioRxiv - Bioengineering 2020Quote: ... The drug screens were performed by the Quellos High Throughput Screening Core (University of Washington, Seattle) with CellTiter-Glo (Promega), as well as with CellTox Green (Promega) ...
-
bioRxiv - Bioengineering 2023Quote: ... Presumptive screening of 10 colonies per mPilA variant was performed via colony-PCR using GoTaq® Green Master Mix (Promega) and forward and reverse primers Diag:71301:MPilA:All:FWD and Diag:71301:MPilA:All:REV (SI Table S1) ...
-
bioRxiv - Cell Biology 2023Quote: Luciferase screening of Envelope subgenomic siRNA potentency and specificity was performed using the Dual-Luciferase Reporter Assay System (Promega, E19190). For initial screening of siRNA potency ...
-
bioRxiv - Cell Biology 2023Quote: ... Nucleofected cells were incubated for 48 h prior to clonal amplification and screening for homozygous clones using target-specific PCR (GoTaq Hot Start, Promega) on genomic DNA using the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... Nucleofected cells were incubated for 48 h prior to clonal amplification and screening for homozygous clones using target-specific PCR (GoTaq Hot Start, Promega) on genomic DNA using the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... + 5% RNAse inhibitor (40U/ul, Promega RNAsin inhibitor N2511). Samples were then transferred to a tube for processing by our Genome Technology Access Center (GTAC ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.1U/µl RNAse inhibitor (Promega RNasin Ribonuclease Inhibitor N2615), and 0.02U/µl DNAse (D4527 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RNAse inhibitors (RNase Inhibitor (Thermo Fisher, Carlsbad, CA, USA, and RNasin® Plus RNase Inhibitor Promega). To each 100 μl of nuclei samples 50 μl of the run-on reaction buffer was added and incubated for 5 min at 30°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNase inhibitor (Promega), 0.05% Tween 20 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... RNase Inhibitor (Promega), 50 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNasin inhibitor (Promega), and thermomixed for 20 minutes at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... The RNase inhibitor (RNasin® Ribonuclease Inhibitor) was purchased from Promega and was ready to use.
-
bioRxiv - Developmental Biology 2019Quote: ... 1 mini tablet of Complete EDTA-free protease inhibitor and 2 µl RNAse inhibitor (RNAsin Plus RNase Inhibitor, Promega). RNA was extracted using the RNASpin Mini kit (GE Healthcare ...
-
bioRxiv - Developmental Biology 2021Quote: ... supplemented with 1.5ul/ml RNAse Inhibitor (RNasin Plus RNase Inhibitor, Promega N2615) and 0.3% IGEPAL CA-630 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and RNase Inhibitor (Promega) were added and incubated at room temperature for 2 hours ...
-
bioRxiv - Neuroscience 2019Quote: ... 1x protease inhibitor (Promega); 1 mg/ml sodium heparin (Sigma) ...
-
bioRxiv - Genomics 2019Quote: ... and RNase inhibitors (Promega #N2615 ...
-
bioRxiv - Neuroscience 2019Quote: ... 1× Protease Inhibitor (Promega), Hoechst 33342 10 ng mL−1 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... 1× Protease inhibitor (Promega), 0.1 mM DTT (Thermo Fisher)] per 100 mg of tissue with 15 strokes of the loose and 15–20 strokes of the tight pestle ...
-
bioRxiv - Immunology 2020Quote: ... and RNase inhibitor (Promega) on ice ...
-
bioRxiv - Cell Biology 2019Quote: ... RNase inhibitor (Rnasin, Promega) was added to the lysate to a final concentration of 1 unit/100 ul ...
-
bioRxiv - Biochemistry 2020Quote: ... RNasin RNase Inhibitor (Promega)) ...
-
bioRxiv - Genetics 2020Quote: ... Ribonuclease inhibitor RNasin (Promega) was added to samples used for RNA sequencing or quantitative PCR (qPCR ...
-
bioRxiv - Genetics 2021Quote: ... Ribonuclease inhibitor RNasin (Promega) was added to samples used for RNA sequencing at a concentration of 0,4 U/μL ...
-
bioRxiv - Cancer Biology 2021Quote: ... U0126 MEK inhibitor (Promega), Wortmannin (HY-10197-10mM/1mL) ...
-
bioRxiv - Immunology 2020Quote: ... and RNasin inhibitor (Promega). The abundance of transcripts from the genes of interest was measured by quantitative real-time PCR with the Light Cycler 480 II system (Roche ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNase inhibitor (RNasin, Promega), 5X buffer ...
-
bioRxiv - Biophysics 2022Quote: ... proteinase inhibitors (Promega G6521) and phosphatase inhibitors (Sigma-Aldrich P0044 and P5726 ...
-
bioRxiv - Neuroscience 2022Quote: ... RNasin Ribonuclease inhibitors (Promega), 10 ng of random primers (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNasin RNase inhibitor (Promega) or RNase T1 was added for RNA-dependent and independent interactome capture ...
-
bioRxiv - Immunology 2023Quote: ... RNasin ribonuclease inhibitor (Promega), DTT (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... RNase inhibitor (Promega, #N2611); Streptavidin (Invitrogen™ ...
-
bioRxiv - Molecular Biology 2023Quote: ... and RNase inhibitor (Promega) in DEPC treated water ...
-
bioRxiv - Molecular Biology 2023Quote: ... and RNase inhibitor (Promega) in DEPC treated water ...
-
bioRxiv - Developmental Biology 2023Quote: ... mRNAs were prepared using the Ambion mMessage Machine kit using Sp6 (#AM1340) supplemented with RNAse Inhibitor (Promega #N251B) after plasmid linearization with Not1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... All mRNAs were prepared using the Ambion mMessage Machine kit using Sp6 (#AM1340) supplemented with RNAse Inhibitor (Promega #N251B).
-
bioRxiv - Developmental Biology 2021Quote: ... and RNAse inhibitors (Promega N2611) and immediately dissected and minced into 1 mm-by-1 mm portions with curved scissors ...