Labshake search
Citations for Promega :
251 - 300 of 4716 citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... DNA for PCR was isolated from 50 µl of tissue lysate using the Maxwell RSC tissue DNA Kit (Promega, Madison, WI, USA).
-
bioRxiv - Plant Biology 2022Quote: ... The two PCR-amplicons were fused by overlap extension PCR and cloned into pGEM-T (Promega) by TA cloning ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were concentrated and gel purified using Wizard SV Gel and PCR cleanup protocol (Promega). Binding reactions consisted of the manufacturer’s binding buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR products were purified with the Wizard SV Gel and PCR Clean-Up System (Promega) and cloned into the pGEM-T Easy Vector (Promega ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The PCR products were purified using the Wizard SV Gel and PCR Clean-Up System (Promega), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified using a Wizard® SV Gel and PCR Clean-up System (Promega). Samples were barcoded using Oxford Nanopore PCR barcodes (EXP-PBC001 ...
-
bioRxiv - Immunology 2022Quote: ... The PCR product was then purified using the Wizard SV 96 PCR Clean-Up System (Promega) and barcoded in a second PCR using two-sided six-nucleotide barcoded primers to discriminate between TCRs of different T cell populations ...
-
bioRxiv - Zoology 2020Quote: ... PCR products were purified with the Wizard SV Gel and PCR Clean–Up System (Promega, USA) and sent for sequencing to Macrogen Inc ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR products were purified (Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI)) and sequenced at the UC Davis DNA Sequencing Facility http://dnaseq.ucdavis.edu/.The DNA sequences were compared against the National Center for Biotechnology Information (NCBI ...
-
bioRxiv - Bioengineering 2020Quote: ... The PCR products were purified using the Wizard SV Gel and PCR Clean-up System (Promega). Purified genomic DNA and RT PCR products (100 ng ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR reaction mixture was formulated using 5 μl GoTaq G2 green PCR master-mix (Promega, USA), 1 μl primer (forward and revers ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR fragment was gel-purified using Wizard SV gel and PCR Clean-up System (Promega), ligated into pGEM-T (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR amplification of exon 2 of the NR2F2 gene was performed using PCR Master Mix (Promega; primer pair is listed in Appendix Table S1) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the Wizard® SV Gel and PCR Clean-Up system (Promega) and then sequenced by Sanger sequencing at GENEWIZ (South Plainfield ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR master mix (Promega, USA) was used as per the manufacturer instructions to amplify the 16s rRNA marker gene ...
-
bioRxiv - Microbiology 2022Quote: ... PCR product was column purified (Promega) for subsequent in vitro transcription of nsp4 RNA using mMESSAGE mMACHINE T7 Transcription Kit (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Standard PCR conditions for GoTaq (Promega) were used as follows ...
-
bioRxiv - Plant Biology 2019Quote: ... GoTaq PCR Mastermix (Promega, Mannheim, Germany) was used to monitor cDNA amplification ...
-
bioRxiv - Developmental Biology 2020Quote: ... 64 µM PCR Nucleotide Mix (Promega), 1.5 mM MgCl2 and 0.2 µM of upstream and downstream primer each ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was column purified (Promega) for subsequent in vitro transcription of N RNA using mMESSAGE mMACHINE T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... PCRs were performed using GoTaq (Promega) on a Veriti thermal cycler (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed with GoTaq (Promega) and with primers listed in Table S9.
-
bioRxiv - Microbiology 2023Quote: ... [26]) and PCR chemicals by PROMEGA© with the following PCR conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR nucleotide mix (Promega, U144B). Quantitative PCRs were performed in triplicate using primers against BNIP3 (Pair 1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... TaqMan universal PCR master mix (Promega) and the CFX96 Touch Real-Time PCR Detection System (BioRad Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR nucleotide mix (Promega, #U144B) were used to synthesise cDNA from 1 mg of RNA ...
-
bioRxiv - Microbiology 2023Quote: ... 0.2 mM PCR Nucleotide Mix (Promega) 10 μM of each primer ...
-
Differential polysaccharide utilization is the basis for a nanohaloarchaeon : haloarchaeon symbiosisbioRxiv - Microbiology 2019Quote: ... Amplicons for cloning were cut out from the gel and purified with the Wizard SV Gel and PCR Clean–up System kit (Promega, Madison, WI, USA). The other Archaea present in the last positive enrichment were identified following the cloning and sequencing of the 16S rRNA gene using the conventional archaeal universal primers A20F-1492R42,43 ...
-
bioRxiv - Cell Biology 2022Quote: ... was used as a template in PCR reactions and amplifications were performed with the GoTaq®G2 Flexi DNA Polymerase kit (Promega, Southampton, UK). Cycling parameters were one cycle of 95°C for 5 minutes for initial denaturation followed by touch-down cycling for the first 14 cycles ...
-
bioRxiv - Genomics 2019Quote: ... amplicons from each replicate were pooled and purified with the Wizard SV Gel and PCR Cleanup System kit (Promega Corporation, Madison, Wisconsin, USA).
-
bioRxiv - Developmental Biology 2020Quote: ... All RACE-PCR products were purified using GeneJET Gel Purification Kit (Fermentas, Hanover, MD, USA) and ligated into pGEM-T vector (Promega, Madison, WI, USA) and transformed into competent JM-109 Escherichia coli cells (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR products were purified with the Nucleospin gel and PCR clean-up kit (Macherey Nagel) and transcribed in vitro using T7 RNA polymerase (RiboMAX system; Promega, Madison, WI, USA). RNA was purified from the sample using the Nucleospin RNA clean-up kit (Macherey Nagel) ...
-
bioRxiv - Bioengineering 2020Quote: ... Homozygous lpat2-3 T-DNA insertional mutants were identified by PCR using Promega PCR Master Mix (Promega) and combinations of the gene specific and T-DNA left border primers pairs ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was then purified using the Wizard® SV Gel and PCR Clean-up System (Promega) and quantified using NanoDrop™ technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing Proteinase K and target regions were amplified by PCR using the GoTaq G2 PCR mastermix (Promega). Correct and unique amplification of the target regions was verified by agarose gel electrophoresis before purifying PCR products using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... The PCR products were purified using the Wizard SV Gel and PCR Clean-up System (A9281, Promega) and the purified templates were used to produce single stranded digoxigenin (DIG)-labelled RNA probes with the T7 (P2075 ...
-
bioRxiv - Developmental Biology 2021Quote: ... a 725bp segment of the Svep1 transcript (NM_153366.4; 746-11179) was PCR amplified (PCR Master Mix, Promega) with one pair of exon-exon boundary overlapping primers (5’ TGTGGTCCTCCAAGTCACGTA 3’ ...
-
bioRxiv - Immunology 2020Quote: ... The PCR fragment was cleaned up using the Wizard SV Gel and PCR Clean-up System (Promega). The fragment was digested with EcoRI-HF and HindIII-HF (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... we purified PCR amplicons using the Wizard® SV Gel and PCR Clean-Up System (Promega, USA) and sequenced purified PCR products with BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems® ...
-
bioRxiv - Immunology 2021Quote: ... containing Proteinase K and target regions were amplified by PCR using the GoTaq G2 PCR mastermix (Promega). Correct and unique amplification of the target regions was verified by agarose gel electrophoresis before purifying PCR products using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were purified using the Wizard PCR Cleanup and Gel Purification system (Promega, Fitchburg, WI, USA).
-
bioRxiv - Plant Biology 2024Quote: ... The second PCR products were purified using the Wizard SV Gel and PCR Clean-up System (Promega) and the Agencourt AMPure XP Kit (Beckman Coulter) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Individual genotyping at every generation was performed via PCR on genomic DNA extracted from larvae pseudopods (Wizard® Genomic DNA Purification Kit, Promega, Madison, WI, USA) using gene-specific primers (forward ...
-
bioRxiv - Plant Biology 2021Quote: ... AccuPrep® Plasmid Mini Extraction Kit (Bioneer Corporation, Republic of Korea) and Wizard® SV Gel and PCR Clean-Up System (Promega Corporation, USA) were used for plasmid and PCR product extraction and purification ...
-
bioRxiv - Plant Biology 2020Quote: Degenerate primers specific to each gene were designed using Primer3plus software [https://primer3plus.com/] for all 17 identified CKX genes following the guidelines for primer design provided by the PCR amplification kit manufacturer (Promega Corporation, USA; Table S2). PCR amplification of the identified CKX GFMs was performed using the reaction kits selected based on the gene size ...
-
bioRxiv - Microbiology 2024Quote: ... DNA fragments such as PCR products or DNA fragment as an agarose gel slices were purified using the Wizard® SV Gel and PCR Clean-Up System kit from Promega (Madison, WI, USA). DNA was digested with the appropriate restriction endonucleases (FastDigest ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products (1.5Kb) of 16S rRNA gene were cleaned with Gel and PCR Clean-Up system (Promega, USA), and quantified by NenoDrop ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) kit for Sanger sequencing.