Labshake search
Citations for Promega :
51 - 100 of 6299 citations for Osteopontin Human OPN ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The plate was read with a plate reader (GloMax® Discover Microplate Reader (Promega) or CLARIOstar Plus Microplate Reader (BMG Labtech) ...
-
bioRxiv - Biochemistry 2019Quote: ... The luminescence signal was developed for 20 min after adding 40 µl kinase detection reagent (kit) and measured with a GloMaxMulti plate reader (Promega). The average of three experiments performed in duplicate and normalized to PI3KC3-C1 activity were determined ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were seeded in 96 wells plate and luciferase activities were measured using Dual-Luciferase Reporter Assay System kit as described by the manufacture (Promega). Fluc/Rluc ratios were determined as relative luciferase activities.
-
bioRxiv - Cancer Biology 2022Quote: ... for 72 hours and cell proliferation was assayed using the CellTiter 96 Non-Radioactive Cell Proliferation kit and a GloMax Discovery plate reader (Promega). For proteomic mass spectrometry ...
-
bioRxiv - Biochemistry 2023Quote: Cells were grown in opaque 96-well white plates and then processed according to the manufacturer’s instructions of the CellTiter-Glo Luminescent Cell Viability Assay kit (Promega # G9241). The standard curve of ATP was determined in parallel for absolute quantitation.
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from overnight cultures on GCB agar plates with appropriate components using Wizard Genomic DNA purification kit (Promega) following manufacturer instructions.
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Promega, Madison, WI, USA) was diluted to 10,000 genome copies per μl then serially diluted to 10 genome copies per μl and used to create a human DNA copy number standard curve ...
-
bioRxiv - Molecular Biology 2019Quote: ... The natural templates include purified human (Promega), rhesus monkey (BioChain) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10.0 ng/ml recombinant human FGF (Promega) and 1.0 μM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human Genomic DNA Male (Promega, cat # G1471) and IDH1 R132H Reference Standard (Horizon ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50ng of normal human genomic DNA (Promega) was used as a negative control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human LAMA1 cDNA was purchased from Promega and sub-cloned into pLVX-Tet-On Advanced vector (Clontech) ...
-
bioRxiv - Genomics 2021Quote: Commercial human DNA (Promega, Cat. No. G1521) was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... These included 5μg/ml human gDNA (Promega), 500ng/ml citrullinated histones (Cayman Chemical #501620) ...
-
bioRxiv - Microbiology 2023Quote: ... Human gDNA (Promega, San Luis Obispo, CA) was added to the extracted gDNA from the clinical swabs to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2024Quote: ... a K562 human peptide digest standard (Promega) and E.coli peptide standard (Waters ...
-
bioRxiv - Genomics 2023Quote: ... Human male genomic DNA (Promega, CAT #G1471) was used for a standard curve at 125 pg/µL ...
-
bioRxiv - Microbiology 2022Quote: ... caspase-1 activity was measured using the Caspase-Glo 1 Inflammasome Assay kit (Promega) per manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... and GloMax plate reader (Promega). Data were normalized to mock-treated ...
-
bioRxiv - Microbiology 2023Quote: ... and GloMax plate reader (Promega). Data were normalized by subtracting Gluc signal from mock-infected cells ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Molecular Biology 2020Quote: Transfection of 1 µg of each individual DNA was performed in six-well plates using FuGENE HD (Promega) for HeLa S3 cells according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2024Quote: ... and incubated for 1 h at room temperature before measuring luminescence using a GloMax Explorer plate reader (Promega). A standard curve was used for quantification of the UDP produced ...
-
bioRxiv - Cancer Biology 2022Quote: ... after which the plate is read for luciferase signal using GloMax Explorer Plate Reader (Promega). For each ratio (CAR-T ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was read at a wavelength of 450nm with a Glomax plate reader (Promega). Toxin concentration in each sample was calculated using the standard curve and normalized by the optical density of the culture ...
-
bioRxiv - Biochemistry 2022Quote: Intracellular glutamate was measured in chondrocytes in 96 well plate format utilizing Glutamate-Glo assay kit (J7021, Promega, Madison, WI USA). Luminescence was measured on microplate reader ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Luciferase activity was assayed in an Omega luminescence plate-reader (Fluostar) with four different gains following the instructions of the Nano Dual-Luciferase® Reporter kit (Promega). A further correction for luminescence bleed-through was applied using the software developed by Mauri et al ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... H12) of each 96 well plate were pooled prior to DNA extraction using Wizard Genomic DNA purification kit (Promega, Madison, Wisconsin). The P0 region including the beginning of galK was amplified for 25 PCR cycles using primers deep_seq_Fw and deep_seq_Rv carrying 5’ adaptors for Illumina sequencing ...
-
bioRxiv - Systems Biology 2019Quote: Caspase 1 activity was measured using commercially available kit (Caspase 1 Glo inflammasome assay, Promega). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... ELISA was performed on the homogenate using the BDNF Emax Immuno Assay Systems (Promega KK, Tokyo, Japan). The hippocampus (HPC ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... bulked to 200ng using human genomic DNA (Promega). All samples were sheared for 150 seconds using a Covaris E220 (Duty Factor 5% ...
-
bioRxiv - Systems Biology 2020Quote: The Human cell lysate was obtained commercially (Promega) and the yeast digest was prepared as previously described23 ...
-
bioRxiv - Genomics 2019Quote: ... We added 4μl pooled commercial human gDNA (Promega) to all samples to ensure total gDNA > 1μg/35μl ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... Human GSK-3β was purchased from Promega (V1991).
-
bioRxiv - Genomics 2020Quote: ... and human gDNA (Promega, San Luis Obispo, CA) was added to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2021Quote: ... and SETD2 human ORF were procured from Promega. Deletion mutants of hnRNP L ...
-
bioRxiv - Biochemistry 2022Quote: Human cancer cell line digest standards K562 (Promega) and diluted to 100 microgram/mL in 50mM TEAB and labeled with TMTPro reagents according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Cell Biology 2023Quote: ... was added to the wells and the plate was introduced into the GloMax plate reader (Promega). The first 7 minutes absorbance was measured at 560nm every minute for baseline pH calibration ...
-
bioRxiv - Cell Biology 2022Quote: ... were seeded onto 6-well plates coated with 0.1 mg ml−1 poly-L-lysine and transfected using FuGENE HD transfection reagent (Promega) with a mixture of third-generation lentiviral backbone vector pJHUMCS that encodes BDNF-pHluorin ...
-
bioRxiv - Immunology 2023Quote: ... RH5ΔNC-specific B cells were identified as live CD19+ IgG+ RH5ΔNC-APC+ RH5ΔNC-PE+ cells and single cell sorted into 96-well plates containing 10µL/well lysis buffer (10mM Tris [T3038, Merck], 1 unit/mL RNasin Ribonuclease Inhibitor [N2515, Promega]) and frozen at -80 °C.
-
bioRxiv - Immunology 2023Quote: ... plates were washed 5 times with wash buffer (PBS with 1% BSA (Capricorn Scientific) and 0.05% Tween-20 (Promega)) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... on the GloMax plate reader (Promega). Each oligo was tested using two biological replicates on different days and each biological replicate consisted of three technical replicates ...
-
bioRxiv - Microbiology 2020Quote: ... and a Glowmax plate luminometer (Promega).