Labshake search
Citations for Promega :
201 - 250 of 4520 citations for Mouse Liver Expressed Antimicrobial Peptide 2 LEAP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: Approximately 5 × 107 control cells and 2 × 107 sort3 PIGS-KO HEK293 cells were used for genomic DNA extraction by Wizard Genomic DNA Purification Kit (Promega). Approximately 325 µg of genomic DNA from control cells and 30 µg of genomic DNA from sort3 cells were used for amplification of gRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was purified from 2 × 106 HCT116 cells harvested 48 hr following reporter transfection using the SimplyRNA cells kit and Maxwell RSC instrument (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: Approximately 6 × 107 control cells and 2 × 107 sort2 cells were used for genomic DNA extraction by Wizard Genomic DNA Purification Kit (A1125, Promega). Approximately 325 μg of genomic DNA from control cells and 60 μg of genomic DNA from sort2 cells were used for amplification of gRNA ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the GoTaq 1-step qRt-PCR kit (Promega) using 3.8µL of extracted RNA and 6.2µL of RT-qPCR mix that contains 250nM of each primer and 75nM of probe ...
-
bioRxiv - Genomics 2021Quote: ... Tris(2-carboxyethyl)phosphine (TCEP) and BCA protein assay kit were from Pierce and sequence-grade trypsin was from Promega. Rapigest and Sep-Pak C18 columns were from Waters and C18 Zip tips were from Millipore ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was then synthesized using 2 μg of mRNA and a Transcriptase first-strand cDNA synthesis kit (Promega, Madison, WI). Real-Time qPCR to detect the indicated targets was performed on a LightCycler® 480 System (Roche Life Science ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCRs were performed with MLV SU or 2-LTR primers (Table 1) using a Power SYBR green PCR kit (Promega) and the QuantStudio 5 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... Purified DNA was run on 2% agarose gel and bands corresponding to ∼150 bp were cut and purified with a Gel Purification kit (Promega). Libraries were constructed using the Nugen Ovation Ultralow Library System V2 following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... ATP solution (5 μL of a 100 μM solution containing 0.1 μg 4:1 glycine:tyrosine peptide substrate (Promega)) was added and incubated at 37 °C for 20 min before the addition of ADP-Glo reagent (5μL ...
-
bioRxiv - Biochemistry 2021Quote: ... Aliquots of reagent were used for sample labeling of a serial dilution of K562 peptide digest standard (Promega) using all heavy N labeled channels that day following manufacturer instructions ...
-
bioRxiv - Biophysics 2021Quote: ... Human Gβ with a C-terminal 15-amino-acid polypeptide linker followed by a HiBiT (peptide 86, Promega) and human Gγ were cloned into pFastBac vector ...
-
bioRxiv - Biochemistry 2022Quote: ... Rat Gβ1 with an N-terminal MHHHHHHSSGLVPRGSHMASHHHHHHHHHH-tag (His16) was fused with the SmBiT subunit (peptide 86, Promega)20 via a 15 amino acid (GSSGGGGSGGGGSSG ...
-
bioRxiv - Plant Biology 2023Quote: ... Total proteome peptide pools were generated by sample digestion overnight with 1:100 sequencing grade trypsin (V5113; Promega). Generated peptide pools were quantified by Nanodrop ...
-
bioRxiv - Cell Biology 2023Quote: ... Peptide digestion was performed by adding 1µg of trypsin (Trypsin Gold, Mass Spectrometry Grade, Promega Corporation, WI, USA) and incubating each sample overnight at 30°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... Culture media was then replaced with 50 µL of qNSC/aNSC media containing 1 mM 2DG (2-deoxy-D-Glucose, provided in Glucose Uptake-Glo kit from Promega (J1342)) reagent for 10 minutes in incubator (humidified ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... equal amount of RNA (2 μg) from each sample was subjected to cDNA synthesis using reverse transcriptase Kit (Promega Corporation, USA) following standard procedures ...
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 µL RNasin (Promega), 250 µL TENT buffer (0.02 M Tris-HCl ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM EDTA (Promega), and 0.5% (v/v ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 mM MgCl2 (Promega), 0.5 µM of each H and L primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsin (2 µg; Promega) was added to the samples before incubation at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... phospho-Erk1/2 (Promega), FAK (C-20 ...
-
bioRxiv - Cell Biology 2022Quote: ... For phospho-peptide samples the volume was increased to 2,000 μl (7-fold dilution) and 30 μg Trypsin Gold (Promega) was added to each sample ...
-
bioRxiv - Neuroscience 2022Quote: ... The mixture was then incubated with 1 μg of AKT substrate II peptide (CKRPRAASFAE) as the Pak4 substrate (Promega) or 1 μg of GST-Raf13 as the Pak1 substrate with a total volume of 5 μL in a 384-well plate (PerkinElmer ...
-
bioRxiv - Immunology 2019Quote: ... then washed three times in lysis buffer and two times in ammonium biocarbonate (50mM) before peptide digestion (V5280, Promega). Peptides were loaded onto a 3-cm self-packed C18 capillary pre-column (Reprosil 5 μM ...
-
bioRxiv - Cancer Biology 2021Quote: ... EV protein samples were alkylated the next day with 50 mM iodoacetamide for 2 hours at ambient temperature in the dark and then digested into peptides with 1.2 µg proteomics-grade trypsin/LysC (Promega) according to the SP3 protocol described by Hughes et al (2019) ...
-
bioRxiv - Physiology 2022Quote: ... The proteins were cleaved into tryptic peptides by addition of 25 μl of a 0.2 μg/μl trypsin (Promega) in 50 mM ammonium bicarbonate and incubation (18 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... The human Gβ1 with a C-terminal 15-amino acid polypeptide linker was followed by a HiBiT (peptide 86, Promega), and the scFv16 was modified with an N-terminal GP67 signaling peptide and a C-terminal 8× histidine tag ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quality control of the instrument setup was monitored using the Promega 6x5 LC-MS/MS Peptide Reference Mix (Promega) and analyzed with the PReMiS software (version 1.0.5.1 ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was initiated by the addition of 1-250 nM acylated peptide (Vivitide) and a 1:10,000 dilution of LgBiT subunit of the NanoBiT luciferase (Promega) and read using an Envision plate reader (XCite 2105 ...
-
bioRxiv - Biochemistry 2023Quote: Serine/threonine phosphatase activity assay of PP2A was performed using the artificial p-peptides RRA(pT)VA substrate (Promega) in lysis buffer containing 1 mM MnCl2 at 70 °C 26 ...
-
bioRxiv - Biochemistry 2023Quote: ... Rat Gβ1 was fused with a His-tag at the N terminus and with a SmBiT subunit (peptide 86, Promega)34 after a 15-amino acid linker at its C terminus ...
-
bioRxiv - Molecular Biology 2021Quote: ... AntiHaloTag (mouse monoclonal, Promega G9211) blot (Figure 1B ...
-
bioRxiv - Cell Biology 2023Quote: ... or anti-mouse HRP (Promega) was diluted in TBST containing 5% dried nonfat milk ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse anti-HaloTag (Promega, G921A), rabbit anti-DDX6 (Bethyl ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-HaloTag (Promega, G9211); rabbit anti-CIMPR (made in house) ...
-
bioRxiv - Cell Biology 2023Quote: ... Halo-Tag (Promega, G9211, mouse), and HSP90 (Santa Cruz Biotechnologies ...
-
bioRxiv - Physiology 2024Quote: ... or anti-mouse HRP (Promega) was diluted in TBST containing 5% dried nonfat milk ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR product was run on 2% agarose gel and the expected bands were eluted using Wizard® SV Gel and PCR cleanup kit (Promega, USA),cloned in pGEM-T easy vector (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... Filters were transferred to 2 mL microfuge tubes for further processing using the Maxwell® RSC PureFood GMO and Authentication Kit (Promega Corporation) with a modified version of the kit protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... The cell viability was assessed by the viability assays 3-(4,5-dimetiltiazol-2-il)-5-(3-carboximetoxifenil)-2-(4-sulfofenil)-2H-tetrazolio (MTS) using the Cell-Titer 96c AQueous Non-Radioactive Cell Proliferation Assay kit (Promega, Madison, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were extracted from a 2% agarose gel and purified using AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, USA) and quantified by QuantiFluor™-ST (Promega, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2021Quote: ... Collisional energy was ramped stepwise as a function of ion mobility.24 Peptide loading was normalized to the total ion chromatograms from 200 ng injections of K562 whole cell lysate standard (Promega).