Labshake search
Citations for Promega :
151 - 200 of 5439 citations for Mouse Butyrophilin Like Protein 2 BTNL2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 2) Thermolysin (Promega) or 3 ...
-
bioRxiv - Microbiology 2021Quote: ... (2) Trypsin (Promega), 4 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Erk1/2 (Promega), phospho-Erk1/2 (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: Protein-protein interaction was analyzed using the NanoBit Protein:Protein Interaction (PPI) System (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: In vitro translated (IVT) proteins were generated in rabbit reticulocyte lysate using the SP6 TNT Quick-Coupled Transcription/Translation kit (Promega, L2080) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2023Quote: ... leaf samples of equal size were collected for protein extractions using the Dual-Luciferase Reporter Assay System kit (Promega, Fitchburg, USA). Glomax 96 microplate luminometer (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... or mouse (W4021; Promega) IgGs ...
-
bioRxiv - Plant Biology 2023Quote: ... or anti-mouse (Promega) in 5% low-fat milk in TBS-T for 1 hour ...
-
bioRxiv - Neuroscience 2019Quote: ... Tissue supernatant were used to estimate BDNF (detection limits 7.8-500 pg/ml) by ELISA (BDNF Emax Immuno Assay System, #G7611, Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Glucose uptake was measured based on the detection of 2-deoxyglucose-6-phosphate uptake by a commercially available luminescence-based kit (Glucose Uptake-GloTM Assay, Promega) on a SpectraMax M3 (Molecular Devices) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and from the interior tissue (at least 2 mm away from the outermost edge of the specimen) using the Wizard Genomic DNA Purification Kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Approximately 5 × 107 control cells and 2 × 107 sort3 PIGS-KO HEK293 cells were used for genomic DNA extraction by Wizard Genomic DNA Purification Kit (Promega). Approximately 325 µg of genomic DNA from control cells and 30 µg of genomic DNA from sort3 cells were used for amplification of gRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was purified from 2 × 106 HCT116 cells harvested 48 hr following reporter transfection using the SimplyRNA cells kit and Maxwell RSC instrument (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: Approximately 6 × 107 control cells and 2 × 107 sort2 cells were used for genomic DNA extraction by Wizard Genomic DNA Purification Kit (A1125, Promega). Approximately 325 μg of genomic DNA from control cells and 60 μg of genomic DNA from sort2 cells were used for amplification of gRNA ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the GoTaq 1-step qRt-PCR kit (Promega) using 3.8µL of extracted RNA and 6.2µL of RT-qPCR mix that contains 250nM of each primer and 75nM of probe ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was then synthesized using 2 μg of mRNA and a Transcriptase first-strand cDNA synthesis kit (Promega, Madison, WI). Real-Time qPCR to detect the indicated targets was performed on a LightCycler® 480 System (Roche Life Science ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCRs were performed with MLV SU or 2-LTR primers (Table 1) using a Power SYBR green PCR kit (Promega) and the QuantStudio 5 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... Purified DNA was run on 2% agarose gel and bands corresponding to ∼150 bp were cut and purified with a Gel Purification kit (Promega). Libraries were constructed using the Nugen Ovation Ultralow Library System V2 following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: PERP protein-protein interactions were isolated using the HaloTag Mammalian Pull-Down System (Promega) and standard protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... and the total protein contents were quantified using BCA Protein Assay Reagent (Promega Corporation). The supernatants were stored at –80 ℃ until subsequent analysis.
-
bioRxiv - Plant Biology 2024Quote: ... Proteins were expressed with TNT SP6 High-Yield Wheat Germ Protein Expression System (Promega) and reactions were incubated for 12h at 25°C with 10µg pIX-HALO expression clone ...
-
bioRxiv - Genetics 2019Quote: ... Purified recombinant luciferase protein (Promega) was used to generate a standard curve.
-
bioRxiv - Genomics 2022Quote: ... and the LgBiT Protein (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Magne Protein G beads (Promega) were used to purify the antibodies according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... In vitro translated proteins (Promega SP6-TNT Quick rabbit reticulocyte lysate system ...
-
bioRxiv - Cancer Biology 2022Quote: ... A BCA protein assay (Promega) was used to determine protein concentration ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HiBiT control protein (#N301A, Promega) dilutions were prepared in the same medium and added (10 µl/well) ...
-
Pushed to the edge: hundreds of Myosin 10s pack into filopodia and could cause traffic jams on actinbioRxiv - Cell Biology 2023Quote: ... Halo Standard Protein (Promega, G4491) samples were prepared for final masses of 1 ng ...
-
bioRxiv - Biochemistry 2023Quote: ... with purified LgBiT Protein (Promega). Briefly ...
-
bioRxiv - Biophysics 2023Quote: ... Protein samples were trypsinized (Promega) in 40mM ammonium bicarbonate (FISHER SCIENTIFIC) ...
-
bioRxiv - Microbiology 2021Quote: ... PA) and AccuMap™ low pH protein digestion kit (with trypsin and lysC) and chymotrypsin (sequencing grade) were from Promega (Madison, WI). PreScisson protease was from GenScript (Piscataway ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... Culture media was then replaced with 50 µL of qNSC/aNSC media containing 1 mM 2DG (2-deoxy-D-Glucose, provided in Glucose Uptake-Glo kit from Promega (J1342)) reagent for 10 minutes in incubator (humidified ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... equal amount of RNA (2 μg) from each sample was subjected to cDNA synthesis using reverse transcriptase Kit (Promega Corporation, USA) following standard procedures ...
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 µL RNasin (Promega), 250 µL TENT buffer (0.02 M Tris-HCl ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM EDTA (Promega), and 0.5% (v/v ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 mM MgCl2 (Promega), 0.5 µM of each H and L primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsin (2 µg; Promega) was added to the samples before incubation at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... phospho-Erk1/2 (Promega), FAK (C-20 ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein samples (about 20 μg of protein) were digested with 500 ng of trypsin (Promega) and peptides were analysed by an Ekspert nanoLC 42 nanoflow system (Eksigent Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... AntiHaloTag (mouse monoclonal, Promega G9211) blot (Figure 1B ...
-
bioRxiv - Cell Biology 2023Quote: ... or anti-mouse HRP (Promega) was diluted in TBST containing 5% dried nonfat milk ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse anti-HaloTag (Promega, G921A), rabbit anti-DDX6 (Bethyl ...