Labshake search
Citations for Promega :
451 - 500 of 3123 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 gp41 1911 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... rabbit anti-NLuc (kind gift of Promega, 1:1000) and b-actin-peroxidase (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... rabbit anti-NLuc (kind gift of Promega, 1:100). The following Alexa Fluor secondary antibodies were used ...
-
Neuronal L-Type Calcium Channel Signaling to the Nucleus Requires a Novel CaMKIIα-Shank3 InteractionbioRxiv - Neuroscience 2019Quote: ... HRP-conjugated anti-rabbit (Promega, catalog W4011, 1:6000), HRP-conjugated anti-mouse (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... and Donkey anti-rabbit HRP (Promega W401B, 1:10,000). Soluble protein samples were normalized to REVERT total protein stain (Li-Cor).
-
bioRxiv - Cell Biology 2022Quote: ... and anti-rabbit IgG HRP (Promega, WB 1:10,000)
-
bioRxiv - Cell Biology 2022Quote: ... and anti-rabbit IgG HRP (Promega, WB 1:10000).
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-cleaved Caspase-3 (1:500 dilution, Promega), mouse anti-GFP (1:1,000 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... pAb rabbit anti-active JNK (V7931, 1:100, Promega) and pAb rat anti-Crb antibody (F3 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-rabbit (1/20000, Promega, W4021 and W4011, respectively) and anti-rat (1/10000 ...
-
bioRxiv - Molecular Biology 2019Quote: Goat anti-rabbit IgG HRP 1:1000 (Promega W4011)
-
bioRxiv - Cell Biology 2023Quote: ... Anti-p-JNK (pTPpY, Promega, USA-1:100 dilution); 8 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Physiology 2020Quote: ... oligo-dT primed cDNA was synthesized from 500 ng of total RNA using Murine Moloney Leukaemia Virus reverse transcriptase (Promega, USA). qRT-PCR was performed using a ViiA Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... the cell viability of each infected virus variants was measured using CellTiter 96 Aqueous One solution Cell Proliferation Assay (Promega, USA). The relative cell viability was calculated by normalizing the absorbance value of treated virus samples against untreated virus samples ...
-
bioRxiv - Cell Biology 2021Quote: ... The primary MEFs were immortalised by transfection of 2 μg of simian virus 40 large T-antigen-expressing vector employing Fugene 6 Transfection Reagent (Promega, E2311) followed by five rounds of a 1 in10 split to achieve 1/100,000-fold splitting ...
-
bioRxiv - Microbiology 2022Quote: ... We performed duplicate serial dilutions using supernatants collected from the virus rescues and measured luciferase expression at each dilution using Bright-Glo Luciferase Assay System (Promega, E2610). Virus titers were calculated as relative light units (RLU ...
-
bioRxiv - Molecular Biology 2023Quote: ... Produced pseudoviruses were titrated on HEK-293T-ACE2 by performing duplicate serial dilutions and virus titers were measured 48 hours after infection using Bright-Glo Luciferase Assay System (Promega, E2610).
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were incubated at 37 °C for two days and the nLuc activity from the virus replication was measured by using Nano-Glo® Luciferase Assay System (Promega) following the manufacturer’s protocol using a plate reader (HT4 Biotek) ...
-
bioRxiv - Immunology 2024Quote: ... The virus neutralization titers were determined by measuring the NLuc activity using the Nano-Glo Luciferase Assay System (Promega, Madison, WI) following the manufacturer’s conditions ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were washed with PBST and then anti-mouse IgG (H&L) alkaline phosphatase-conjugated secondary antibody (Promega) was incubated with the membrane at a 1:5,000 dilution for 1 h at RT ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... bulked to 200ng using human genomic DNA (Promega). All samples were sheared for 150 seconds using a Covaris E220 (Duty Factor 5% ...
-
bioRxiv - Systems Biology 2020Quote: The Human cell lysate was obtained commercially (Promega) and the yeast digest was prepared as previously described23 ...
-
bioRxiv - Genomics 2019Quote: ... We added 4μl pooled commercial human gDNA (Promega) to all samples to ensure total gDNA > 1μg/35μl ...
-
bioRxiv - Biochemistry 2020Quote: ... Human GSK-3β was purchased from Promega (V1991).
-
bioRxiv - Genomics 2020Quote: ... and human gDNA (Promega, San Luis Obispo, CA) was added to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2021Quote: ... and SETD2 human ORF were procured from Promega. Deletion mutants of hnRNP L ...
-
bioRxiv - Biochemistry 2022Quote: Human cancer cell line digest standards K562 (Promega) and diluted to 100 microgram/mL in 50mM TEAB and labeled with TMTPro reagents according to manufacturer instructions ...
-
bioRxiv - Genetics 2019Quote: ... As secondary antibodies horseradish peroxidase (HRP)-conjugated α-mouse or α-rabbit IgG (Promega, 1:4000) were used ...
-
bioRxiv - Plant Biology 2020Quote: ... corniculatus plants was synthesized from 3 μg of total RNA using a Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV-RT) (Promega, WI, USA) and 100 pmol of random hexamers (Pharmacia Biotech) ...
-
bioRxiv - Molecular Biology 2021Quote: cDNA synthesis for gene expression analyses was performed using 500 ng RNA using Moloney murine leukemia virus (M-MLV) reverse transcriptase and random hexamer oligonucleotide (both from Promega, Southampton, UK) using 500 ng RNA in a 25 µl reaction ...
-
bioRxiv - Biochemistry 2020Quote: ... Moloney murine leukemia virus reverse transcriptase (MMLV-RT) enzyme and recombinant RNasin® ribonuclease inhibitor were purchased from Promega (Madison, WI, USA). Evagreen 2X qPCR MasterMix was purchased from Applied Biological Materials Inc ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting materials were used as template to generate cDNA using 100 U Moloney murine leukemia virus (MMLV) reverse transcriptase (Promega, Madison, WI), 0.45 μM N6 random hexamer primers (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: DNA was extracted from this concentrated virus sample using a modified protocol with the Wizard Genomic DNA Purification Kit A1120 (Promega, Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2019Quote: ... virus replication was quantified by measuring Renilla luciferase activity (relative light units [RLU]) using Bright-Glo™ Luciferase Assay System (Promega, USA) 48 hours post-reinfection ...
-
bioRxiv - Microbiology 2019Quote: ... Virus infectivity was quantified by measuring Renilla luciferase activity (relative light units [RLU]) using Bright-Glo™ Luciferase Assay System (Promega, USA) on the Tecan microplate reader (Tecan Infinite® 200 Pro ...
-
bioRxiv - Cell Biology 2020Quote: ... Total 500 ng RNA was used to synthesize cDNA by using Moloney-murine leukemia virus (M-MLV) reverse transcriptase (Promega, Madison, WI). Diluted cDNA was used in each quantitative reverse transcription-PCR (qRT-PCR) ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNAs were synthesized from 1.5 μg of total RNA with oligo(dT) primers using Moloney Murine Leukemia Virus Reverse Transcriptase MMLV-RT according to the manufacturer’s instructions (Promega, Madison, WI, USA). RT-qPCR was carried out in a Chromo4 system (Bio-Rad ...
-
Mucociliary Clearance Augmenting Drugs Block SARS-Cov-2 Replication in Human Airway Epithelial CellsbioRxiv - Microbiology 2023Quote: ... The plates were incubated at 37°C under 5% CO2 for 144 hour and virus cytopathic effect was measured using the CellTiter-Glo® 2.0 Cell Viability Assay (Promega, Cat. # G9241) following the manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... the amount of input virus was normalized to the HiBiT value measured by Nano Glo HiBiT lytic detection system (Promega, Cat# N3040)] ...
-
bioRxiv - Microbiology 2023Quote: ... Samples where a 1 log decrease in RLU compared to the no-serum virus-only control was observed were then selected for cytotoxicity assay using Cell Titre Glo kit (Promega, Southampton, UK) and light microscopy to verify viability of cells prior to undertaking PVNA (data not shown) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by reverse transcription to complementary DNA (cDNA) using 30 enzyme units(U) of the Moloney Murine Leukemia Virus reverse transcriptase (MMLV-RT) (Promega, WI, USA). The extension products were then analysed using the ABI3730xl DNA Analyzer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... or goat anti-rabbit IgG at 1:3000 (Promega W4011). Washes were with high-salt TBST (50 mM Tris pH 7.5 400 mM NaCl 0.1% Tween-20).
-
bioRxiv - Biochemistry 2020Quote: ... HRP-conjugated anti-rabbit IgG (Promega, WI; 1:3000-5000), HRP-conjugated anti-goat IgG (Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... Goat anti-rabbit IgG conjugated to HRP (1:5,000) (Promega) was used to detect the bound protein ...
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies include anti-NLuc rabbit polyclonal (1:6,000) (Promega), anti-mCherry rabbit polyclonal (1:5,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-rabbit IgG HRP (Promega, Madison, WI, W401B, 1:10,000) or anti-goat IgG HRP (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-Halo antibody was purchased from Promega (G9211; 1:1000). Anti-actin-HRP antibody (C4 ...