Labshake search
Citations for Promega :
151 - 200 of 2859 citations for Mac 1 SAP mouse human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-T-Cofilin 1:2000 (Bamburg lab, 1439 or Cell Signalling, 5175) and mouse anti-β3-tubulin 1:2000 (Promega, G7121) diluted in 1%BSA/PBS and incubated overnight at 4ºC ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Molecular Biology 2021Quote: ... secondary antibody staining was performed for 1 h at room temperature using anti-rabbit HRP or anti-mouse HRP secondary antibodies (Promega, 1:10,000) in blocking buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... secondary antibody staining was performed for 1 h at room temperature using antirabbit HRP or anti-mouse HRP secondary antibodies (Promega,1:10,000) in blocking buffer ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... bulked to 200ng using human genomic DNA (Promega). All samples were sheared for 150 seconds using a Covaris E220 (Duty Factor 5% ...
-
bioRxiv - Systems Biology 2020Quote: The Human cell lysate was obtained commercially (Promega) and the yeast digest was prepared as previously described23 ...
-
bioRxiv - Genomics 2019Quote: ... We added 4μl pooled commercial human gDNA (Promega) to all samples to ensure total gDNA > 1μg/35μl ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... Human GSK-3β was purchased from Promega (V1991).
-
bioRxiv - Genomics 2020Quote: ... and human gDNA (Promega, San Luis Obispo, CA) was added to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2021Quote: ... and SETD2 human ORF were procured from Promega. Deletion mutants of hnRNP L ...
-
bioRxiv - Biochemistry 2022Quote: Human cancer cell line digest standards K562 (Promega) and diluted to 100 microgram/mL in 50mM TEAB and labeled with TMTPro reagents according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Primary antibodies and the dilutions used are as follows: anti-Halo (mouse, Promega G9211, 1:200); anti-Ezh2 (mouse ...
-
bioRxiv - Neuroscience 2020Quote: ... all cells were incubated in the following: mouse anti-βIII tubulin (1:1000; 2 hr; Promega) and goat anti-mouse Alexa 546 (1:1000 ...
-
bioRxiv - Cancer Biology 2019Quote: ... were secondary incubated with anti-mouse IgG (H+L) horseradish peroxidase coupled (1:3,000, W402b, Promega) and polyclonal anti-rabbit IgG (1:5000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies used were: rabbit and mouse anti-βGal (1/1000; Promega and MP Biomedicals, respectiveley), rat anti-Ser (1/1000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then with 1:5000 of anti-rabbit (#W401B) or anti-mouse (#W402B) secondary antibodies (Promega).
-
bioRxiv - Genetics 2019Quote: ... As secondary antibodies horseradish peroxidase (HRP)-conjugated α-mouse or α-rabbit IgG (Promega, 1:4000) were used ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated for 1 h with the secondary antibody anti-mouse IgG HRP conjugate (W4021, Promega, U.S.A.) diluted at 1/3000 in 10% Blocking One/TTBS ...
-
bioRxiv - Neuroscience 2020Quote: ... Tissues were then stained using the following primary antibodies overnight: mouse anti-β Galactosidase (1:1000; Promega), rabbit anti-Er81 (1:5000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The membrane was probed with α-Halotag mouse monoclonal antibody (Promega, diluted 1:1000 in Blocking Buffer), washed 3 times in TBS-Tween ...
-
bioRxiv - Molecular Biology 2020Quote: ... then probed with goat α-mouse HRP-conjugated secondary antibody (Promega, diluted 1:10000 in Blocking Buffer) and finally washed 3 times in TBS-Tween ...
-
bioRxiv - Developmental Biology 2023Quote: ... The secondary antibody used was HRP-conjugated goat/rabbit/donkey anti-mouse IgG (1 : 10000, Promega, W402B).
-
bioRxiv - Biochemistry 2023Quote: ... cells were incubated with a 1:100 dilution of primary mouse anti-NLuc antibody (Promega, cat#7000) in PBS overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... and human Renilla luciferase (pGL4.74[hRluc/TK], Promega, E6921) were used in the study ...
-
bioRxiv - Microbiology 2020Quote: ... insert (NRP1, native human ORF in pF1K, FXC23812, Promega): 5’-atagggcgaattcggtagtaaggagcgatcgc-3’ (fwd ...
-
bioRxiv - Cancer Biology 2022Quote: ... were amplified by PCR from human genomic DNA (Promega), using the primers listed in Table S1 and then inserted into the psiCHECK-2 vector ...
-
bioRxiv - Biochemistry 2022Quote: ... human GR and MR were cloned into pACT (Promega) as N-terminal VP16 fusions using HiFi assembly (NEB) ...
-
bioRxiv - Cell Biology 2019Quote: ... A cDNA encoding human KIF1A was purchased from Promega Japan (Promega Japan ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Human PAR2 with N-terminal nano-luciferase (nLuc, Promega) and C-terminal enhanced Yellow Fluorescent Protein (eYFP ...
-
bioRxiv - Molecular Biology 2021Quote: ... or goat anti-Human IgG (H+L) (Promega, W4031) antibodies were added for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... or mouse (W4021; Promega) IgGs ...
-
bioRxiv - Plant Biology 2023Quote: ... or anti-mouse (Promega) in 5% low-fat milk in TBS-T for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... the following primary antibodies were used at the indicated concentrations: 1:10’000 mouse anti-β3-Tubulin (Promega, G712A), rabbit anti-p-ERK T202/Y204 (CST ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein bands were detected with horseradish peroxidase (HRP)-conjugated rabbit or mouse secondary antibody [1:1,000 dilution] (Promega). The chemiluminescence signal was imaged using an Odyssey XF Imager (LI-COR ...
-
bioRxiv - Biochemistry 2023Quote: ... Anti-HiBiT western blot was then performed with 1:5,000 dilution of mouse anti-HiBit (Promega, Clone 30E5) and 1:10,000 dilution of goat anti-mouse-HRP secondary antibody (Invitrogen).
-
bioRxiv - Biochemistry 2023Quote: ... Anti-HiBiT western blot was then performed with 1:5,000 dilution of mouse anti-HiBit (Promega, Clone 30E5) and 1:10,000 dilution of goat anti-mouse-HRP secondary antibody (Invitrogen).
-
bioRxiv - Cancer Biology 2023Quote: ... The secondary antibodies used in this study were 1:2,500-diluted HRP-conjugated anti-mouse IgG (Promega, #W4021) and anti-rabbit IgG (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: The CD19 minigene was amplified from human genomic DNA (Promega) with the primers 5’-catAAGCTTgaccaccgccttcctctctg-3’ and 5’-catGAATTCNNNNNNNNNNNNNNNGGATCCttcccggcatctccccagtc-3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... the human CB1R was cloned into the pCI vector (Promega), and eCB2.0 and eCBmut were cloned into the peGFP-C1 vector (Takara) ...
-
bioRxiv - Immunology 2022Quote: ... and a β-globin calibration curve (human genomic DNA [Promega]) was concurrently evaluated on each plate ...
-
bioRxiv - Microbiology 2020Quote: ... The human codon-optimized NanoLuc Luciferase reporter gene (Nluc, Promega) was inserted in place of nucleotides 1-100 of the nef-gene ...
-
bioRxiv - Genomics 2022Quote: ... 10 ng/mL recombinant human basic fibroblast growth factor (Promega), and 1 μM dexamethasone (Sigma-Aldrich) ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... donovani BPK282/0 cl4 promastigote DNA with human DNA (Promega) from 1/15 to 1/150000 (Leishmania:human ...
-
bioRxiv - Biochemistry 2020Quote: hnRNP L and SETD2 human ORF were procured from Promega. Deletion mutants of hnRNP L and SETD2 were constructed by PCR (Phusion polymerase ...
-
bioRxiv - Immunology 2020Quote: ... The human codon-optimized nanoluc Luciferase reporter gene (Nluc, Promega) was inserted in place of nucleotides 1-100 of the nef-gene ...