Labshake search
Citations for Promega :
201 - 250 of 274 citations for Lifeink 200 Collagen Bioink since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... Collisional energy was ramped stepwise as a function of ion mobility.24 Peptide loading was normalized to the total ion chromatograms from 200 ng injections of K562 whole cell lysate standard (Promega).
-
bioRxiv - Microbiology 2021Quote: ... transparent bottom) was inoculated with 200 µL of the washed germlings and used for fluorescence measurements using a fluorimeter (Promega GloMax® explorer multimode microplate reader ...
-
bioRxiv - Biochemistry 2022Quote: ... Remaining iodoacetamide was quenched by adding 5 mM DTT and the proteins were digested with 200 ng trypsin (Trypsin Gold, Promega) at 37 °C ON ...
-
bioRxiv - Biochemistry 2022Quote: ... which had been pre-incubated in 200 μL Ex-Cell 420 medium plus 5 μL FuGENE HD transfection reagent (Promega) for 20 minutes at 27 °C ...
-
bioRxiv - Genomics 2022Quote: ... Then the gel beads were washed with DPBS three times and 200 μL of proteinase K solution (1 mg/mL proteinase K [Promega, Madison ...
-
bioRxiv - Biochemistry 2021Quote: ... Halo-tagged ubiquitin-binding domains (UBDs) of TUBE (tandem-repeated ubiquitin-binding entities) was incubated with HaloLink resin (200 μL, Promega) in binding buffer (50 mm Tris⍰HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 4 µl of the lysates were mixed with 20 µl of Renilla Luciferase Assay Buffer and 1/200 of substrate from the Renilla Luciferase assay system (Promega) and measured immediately in a luminometer for 2 seconds ...
-
bioRxiv - Microbiology 2019Quote: ... 293T cells stably expressing HA-tagged PPP2R5B or APOBEC3G were transfected with 200 ng/well control or Vif expression vector in 24-well plates using FuGENE 6 (Promega). After 36 hr ...
-
bioRxiv - Microbiology 2020Quote: ... protein lanes were cut into 10 pieces, destained (600 rpm, 37 °C, 200 mM NH4HCO3 in 30% acetonitrile) and digested with trypsin (sequencing grade, Promega) overnight at 37 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... Gene PCR products of 200-300 bp were labelled with 32P-dCTP following the prime-a-gene labelling kit instructions (Promega) and used as probes (Supplementary Table 1) ...
-
bioRxiv - Biochemistry 2021Quote: ... and 20 mM iodoacetamide respectively and washed again twice with 200 μl of 100 mM aqueous TEAB before incubating with 2 μg of trypsin (proteomics grade, Promega) at 37°C for 4h ...
-
bioRxiv - Biochemistry 2020Quote: ... and bound proteins were digested for ∼14 hr at 37°C in 200 μL of trypsin premix solution containing sequence grade trypsin (2 mg, Promega), urea (0.5 M in 200 mM EPPS pH 8.4) ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM MgCl2, 1.5 mM KCl, 100 μ g/ml cycloheximide, 1mM DTT, 200 U/ml RNase in from Promega, 0.5% Sodiumdeoxycholate ...
-
bioRxiv - Physiology 2023Quote: ... The cultured media was replaced with 2 ml of DMEM media supplemented with 200 μM Beetle luciferin (Promega, Wisconsin, Madison). BMAL1Luc HDFs’ bioluminescence was measured continuously with a Kronos Dio Real-time luminometer (Atto ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins bound to magnetic beads were washed twice with 100 μL of 25 mM NH4HCO3 and on-beads digested with 200 ng of trypsine/LysC (Promega) for 1 hour in 100 μL of 25 mM NH4HCO3 at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... The synthesis of cDNA was achieved by incubation in a 20 µl reaction mixture containing 200 U of MMLV Reverse Transcriptase (Promega) and 500 ng of random primer (Roche ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 100 ng of either XeARPP19 or ClyARPP19 were incubated with 200 μM ATP and 25 units of recombinant bovine PKA (Promega) in PKA Buffer for 3 hours at 37°C under 1200 RPM stirring ...
-
bioRxiv - Plant Biology 2023Quote: The HLB1 coding sequence corresponding to the N-terminal 200 amino acids was amplified by PCR using the following primers and was cloned into pGEM-T-easy vector (Promega). The NdeI and XhoI fragment of HLB11-200 was cloned into pET28a vector (Novagen ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR-amplified libraries were purified and size selected for fragments of 200-250bp using the Pronex paramegnetic beads (Promega # NG2001) according to manufacturer instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... tumor fragments (200-300 mg) were lysed for 1 h on ice with agitation in 1X Reporter Cell Lysis Buffer (Promega) and then centrifuged at 14,000 x g for 15 min at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated for 1 h at 37 °C with fresh complete DMEM containing JFX646 HaloTag ligand (200 nM; GA112A; Promega), washed twice with PBS 1X and imaged on an Elyra 7 with Lattice SIM² microscope (Zeiss ...
-
bioRxiv - Microbiology 2023Quote: ... A nested PCR for the detection of the FRT-scar present in RDV-50.stop MHV68 was performed using 200 ng of genomic DNA with GoTaq polymerase (Promega) using primers (dPCR_R1_for GGACCACGCTTTCCAGAGAA ...
-
bioRxiv - Neuroscience 2023Quote: ... Blots were then incubated with blotting buffer containing 1:200 LgBiT for 1-2 h with rocking at RT (N2410, Promega). Next ...
-
bioRxiv - Molecular Biology 2023Quote: ... Culture aliquots (200 µL) were taken to measure OD620 and luminescence by adding 10 µL of 1 mg/mL beetle luciferin (Promega) in a BioTek Cytation 3 Microplate Reader ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were incubated at 37 °C for 24 h and then they were washed with 200 μL PBS per well and harvested in 100 μL per well of passive lysis buffer (Promega). Cells were freeze-thawed and 25 μL of lysate from each well was added to 25 μL of firefly luciferase reagent (Bright-Glo ...
-
bioRxiv - Cell Biology 2024Quote: ... The protein pellets were resuspended in 50 μl 100 mM TEAB and digested with 200 ng trypsin (Promega sequencing grade) overnight at 37°C.
-
bioRxiv - Microbiology 2023Quote: ... Fresh MEM supplemented with 200 μM GCDCA was then added on the cells in the presence or absence of Z-VAD-FMK (Promega), NH4Cl (Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... Flp-In T-REX HeLa cells were transfected with 1.8 μg of pOGG4 plasmid and 200 ng of pcDNA5/FRT/TO plasmid encoding the relevant transgene cassette using FuGENE HD transfection reagent (Promega). Cells with a stably integrated transgene were selected with 150 μg/mL hygromycin for 4-5 days ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: β-arrestin2 recruitment to human chemokine receptors in response to 1 µM VUF15485 or 200 nM positive control chemokines was also monitored by NanoLuc complementation assay (NanoBiT, Promega) (Dixon et al. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113).
-
bioRxiv - Bioengineering 2019Quote: ... using a reaction solution consisting of RNA (100 or 200 ng) supplemented with 1 μL random primers (50 ng μL−1, Promega, C1181), 1 μL dNTPs (10 mM ...
-
bioRxiv - Cell Biology 2020Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113). After digestion ...
-
bioRxiv - Biochemistry 2022Quote: ... Total RNA from SVF or 3T3-L1 adipocyte-differentiated cells (at day 10 of differentiation) (200 ng) was reverse transcribed using (MMLV) reverse transcriptase following the manufacturer’s protocol (Promega - Madison, WI). Expression of genes encoding the Pparγ2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.5% sodium deoxycholate (protect from light), 1:200 Protease Inhibitor Cocktail III), and then, incubated with RNase I (Life Technology, AM2295) and DNase (Promega, M6101) in a Thermomixer at 1200 rpm to fragment RNA at 37 °C for 10 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... The RSB/RNasin buffer (2 ml) was prepared fresh and contained 200 ul of 10 X RSB and 50 ul RNasin (N2511, Promega, USA). The PEB buffer (10 ml ...
-
bioRxiv - Microbiology 2021Quote: ... 100 μL of this suspension containing 106 parasites were transferred into black clear-bottom 96-well plates and serial 2-fold dilutions were performed in triplicate adjusting the final volume to 200 μL with 300 μg/mL of beetle luciferin (Promega, France). Luciferase activity was quantified after 10 min of incubation with an IVIS Spectrum imager (PerkinElmer) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Sorted cells were collected in 1.5 ml Eppendorf tubes containing 200 µl of DMEM 10% FBS medium and immediately processed for RNA extraction using ReliaPrep™ RNA Cell Miniprep System (Promega) and DNAse TURBO (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2019Quote: ... alkylated with 200 mM MMTS (45 min at room temperature) and digested overnight with trypsin (sequencing grade modified Trypsin - Promega V5111).
-
bioRxiv - Systems Biology 2020Quote: ... Samples were dried in a vacuum centrifuge and resuspended in 200 uL of 0.05 ug/uL Lys-C/Trypsin (Promega, WI, USA) in 25 mM Ammonium Bicarbonate ...
-
bioRxiv - Bioengineering 2021Quote: ... Plasmid DNA input was produced by midi prepping an overnight culture of 200 mL LB with the appropriate strain (Promega, A2492) and cleaned again using PCR cleanup (Promega ...
-
bioRxiv - Immunology 2021Quote: ... RNA concentration was determined by NanoDrop 1000 Spectrophotometer (ThermoScientific).1 µg of total RNA was reverse transcribed into cDNA with M-MLV Reverse Transcriptase 200 units (Promega, #M1701), Random Primer 0.5 μg (Promega ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... cells were washed once with 200 µl of dPBS and subsequently analyzed using a Dual-Luciferase Reporter Assay System kit (Promega E1910) according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Neuroscience 2022Quote: ... The gel pieces were dried with 200 μl of ACN and digested with 10 ng/μl Lys-C (sequencing grade, Promega, USA) in 50 mM NH4HCO3 overnight at 37 °C (14).
-
bioRxiv - Physiology 2022Quote: ... Protein concentration in the supernatant was measured using a NanoDrop and 1:200 (w/w) of trypsin (Promega, Mass Spectrometry grade) was added to 200 µg of sample ...
-
bioRxiv - Immunology 2023Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113). After digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 min) and diluted to 1M Urea with 200 mM ABC for trypsin digestion (1 μg, 37°C, overnight shaking, Promega, #V5113). On the next day ...
-
bioRxiv - Microbiology 2023Quote: ... 100 μL of this suspension containing 106 parasites were transferred into black clear-bottom 96-well plates and serial 2-fold dilutions were performed in triplicate adjusting the final volume to 200 μL with 300 μg/mL of beetle luciferin (Promega, France). Luciferase activity was quantified after 10 min of incubation with an IVIS Spectrum imager (PerkinElmer) ...
-
bioRxiv - Immunology 2023Quote: ... Pre-digestion of bound proteins was performed by addition of 200 ng / µl LysC (FUJIFILM Wako Pure Chemical Corporation, 125-02543) and trypsin (Trypsin Gold, Mass Spec Grade, Promega, V5280) mixed 1:1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein-bound magnetic beads were washed three times with 200 µl of 80% ethanol and reconstituted in 50 mM TEAB and digested with trypsin (Promega, V5111) at a 1:50 enzyme-to-substrate ratio for 16 h at 37 °C with constant shaking (1000 rpm) ...