Labshake search
Citations for Promega :
51 - 100 of 2721 citations for LIR 1 LILRB1 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: The recruitment of PTH1R to β-arrestin was detected in HEK293 cells using the NanoLuc Binary System (NanoBiT; Promega). The Lgbit subunit was fused to the C-terminus of PTH1R and the SmBiT subunit was fused to the N-terminus of β-arrestin ...
-
bioRxiv - Developmental Biology 2023Quote: ... HEK293 culture medium was replaced by imaging medium containing either Janelia Fluor 646 (JF646) ligand (10 nM; Promega, #GA1120) or OregonGreen ligand (50 nM ...
-
bioRxiv - Immunology 2020Quote: ... pCAG-Flag or pCMV-HA-N expression vectors using standard molecular cloning methods as described in our previous publications.30–32 The IFN-β luciferase reporter plasmid pGL3-IFN-β-Luc vector was constructed in our previous study.33,34 The IFNλ1 luciferase reporter plasmid pGL3-IFNλ1-Luc was constructed by inserting the 1000-bp promoter region of human IFNλ1 (nucleotides −1000 to +1, with the translation start site set as 1) into pGL3-Basic (Promega, USA) according to methods outlined in previous studies.13,34 The ISG luciferase reporter plasmid pISRE-Luc vector was purchased from Clontech (USA) ...
-
bioRxiv - Immunology 2022Quote: ... into 293T cells in DMEM medium + 10% FCS using Fugene 6 (Promega) for pseudoviruses production ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5ng ml-1 recombinant human fibroblast growth factor (rhFGF) (Promega, Cat#G5071, Madison, WI, USA), and 1% chicken embryonic extract (Seralab ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293 cells were co-transfected with FLAG-tagged receptor constructs and luciferase-based 22F cAMP biosensor (Promega, Cat. no. E2301) using polyethylenimine (PEI ...
-
bioRxiv - Cell Biology 2019Quote: Approximately 5 × 107 control cells and 2 × 107 sort3 PIGS-KO HEK293 cells were used for genomic DNA extraction by Wizard Genomic DNA Purification Kit (Promega). Approximately 325 µg of genomic DNA from control cells and 30 µg of genomic DNA from sort3 cells were used for amplification of gRNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... Virus-like particles (VLPs) containing the GFP control or targeting sgRNAs were generated by transfection of HEK293 cells with FuGene (Promega). VLPs were collected from culture supernatant ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant DJ-1 protein (1 μM) was added to the transfected HEK293 cell lines and luciferase activities were measured using a Luciferase Assay System (Promega). 10 μg mL−1 of peptidoglycan (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 μg of psPAX2 packing plasmid and 2 μg of pM2G envelope plasmid were transfected into HEK293 Lenti-X cells using 30 μL of Fugene-HD (Promega) in antibiotic-free DMEM ...
-
bioRxiv - Immunology 2022Quote: ... 5×106 HEK293 cells were plated in 15cm petri dishes and transfected the day after with 50 μL FuGENE (E2311, Promega), 10 μg CAR-encoding vectors and 3.3 μg of each 3rd generation lentivirus helper vectors (CART-027CL ...
-
bioRxiv - Immunology 2023Quote: ... and the corresponding SARS-CoV-2 spike construct were co-transfected in HEK293-T cells using FuGENE 6 Transfection Reagent (Promega) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Immunology 2022Quote: ... 5×106 HEK293 cells were plated in 15 cm petri dishes and transfected the day after with 50 μL FuGENE (E2311, Promega), 10 μg CAR-encoding vectors and 3.3 μg of each 3rd generation lentivirus helper vectors (CART-027CL ...
-
bioRxiv - Molecular Biology 2024Quote: ... The -1 PRF efficiency was assayed in cultured HEK293 as described previously (Kelly et al. 2020) using dual-luciferase reporter assay system kit (Promega). 24 hr post transfection ...
-
bioRxiv - Systems Biology 2020Quote: ... Human cell lysate (MS Compatible Human Protein Extract, Digest, V6951) were purchased from Promega.
-
bioRxiv - Neuroscience 2020Quote: ... All designed probes were tested by ddPCR using human genomic DNA (Human male, Promega) as a negative control ...
-
bioRxiv - Microbiology 2020Quote: Plasmids encoding each vector were transfected into HEK293 cells seeded in 10 cm plates using Fugene 6™ (Promega, Madison, WI) or polyethyleneimine ...
-
bioRxiv - Neuroscience 2021Quote: Luminescence assays to monitor cAMP levels were performed as we described previously (Siuda et al., 2015). Briefly, HEK293 cells (ATCC, cat. # CRL-1573) were co-transfected with PPO-Venus and pGloSensor-22F (Promega E2301) plasmids using JetPrime reagent (Polyplus ...
-
bioRxiv - Molecular Biology 2023Quote: ... NLS-NSD2-mVenus WT and T1150A plasmids were transfected into 70 % confluent HEK293 SETD2 knockout cells using FuGENE® HD Transfection Reagent (Promega). NLS-mVenus empty vector was used as a negative control ...
-
bioRxiv - Molecular Biology 2023Quote: ... a mixture of the 3 Cas9-sgRNA plasmids (150ng/μl) was transfected into HEK293 cells at 70% confluency in fresh medium using FuGENE® HD Transfection Reagent (Promega). Two days after transfection ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were co-transfected in a 1:1 ratio with either human D1 or D2Long receptor and a split-luciferase based cAMP biosensor (GloSensor, Promega, Durham NC). The next day ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human Genomic DNA (G1521, Promega) was used as positive control and synthetic DNA was used to validate the LAMP assay performance ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK293 cells were transfected with a PPRE-firefly luciferase reporter plasmid together with phRL-TK Renilla luciferase control vector (Promega, Madison, WI), pCMX-PPARα ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 bacterial artificial chromosome and human genome Promega #G1471). Absolute copy number of genomic stocks was determined using droplet digital PCR (Biorad QX600) ...
-
bioRxiv - Microbiology 2020Quote: ... 500 ng human genomic DNA (Promega) or 5 μl of untreated or RNase-treated nasal swab nucleic acid isolates ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pooled human male genomic DNA (Promega) was randomly sheared (500-800bp ...
-
bioRxiv - Systems Biology 2021Quote: ... a human cDNA pool (Promega Corporation), or obtained as synthesized double-stranded DNA fragments (gBlocks ...
-
bioRxiv - Genomics 2021Quote: ... 50ng human genomic DNA (Promega, G304A), 2µM assembled T7-Tn5 transposase or Tn5 transposase was incubated at 55 °C for 7minutes ...
-
bioRxiv - Immunology 2023Quote: ... Lumit Human IL-1β Immunoassay (Promega) was performed according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... human Female genomic DNA (Promega #G1521), as a reference ...
-
bioRxiv - Neuroscience 2019Quote: ... genomic DNA from puromycin selected cells and wild-type HEK293 cells was extracted (Promega Wizard Genomic DNA Purification Kit #A1120; Promega, Madison, WI, USA) for PCR amplification of a 535 bp region flanking the sgRNA cleavage site ...
-
bioRxiv - Biochemistry 2021Quote: ... selections were performed using biotinylated c-CDCP1-Fc captured on SA-coated magnetic beads (Promega). Prior to each selection ...
-
bioRxiv - Bioengineering 2023Quote: ... selections were performed using biotinylated Fc fusion antigen captured on SA-coated magnetic beads (Promega). Prior to each selection ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Promega, Madison, WI, USA) was diluted to 10,000 genome copies per μl then serially diluted to 10 genome copies per μl and used to create a human DNA copy number standard curve ...
-
bioRxiv - Molecular Biology 2019Quote: ... The natural templates include purified human (Promega), rhesus monkey (BioChain) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10.0 ng/ml recombinant human FGF (Promega) and 1.0 μM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human Genomic DNA Male (Promega, cat # G1471) and IDH1 R132H Reference Standard (Horizon ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50ng of normal human genomic DNA (Promega) was used as a negative control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human LAMA1 cDNA was purchased from Promega and sub-cloned into pLVX-Tet-On Advanced vector (Clontech) ...
-
bioRxiv - Genomics 2021Quote: Commercial human DNA (Promega, Cat. No. G1521) was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1 ...
-
bioRxiv - Microbiology 2023Quote: ... Human gDNA (Promega, San Luis Obispo, CA) was added to the extracted gDNA from the clinical swabs to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Immunology 2022Quote: ... These included 5μg/ml human gDNA (Promega), 500ng/ml citrullinated histones (Cayman Chemical #501620) ...
-
bioRxiv - Genomics 2023Quote: ... Human male genomic DNA (Promega, CAT #G1471) was used for a standard curve at 125 pg/µL ...
-
bioRxiv - Biochemistry 2024Quote: ... a K562 human peptide digest standard (Promega) and E.coli peptide standard (Waters ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Biochemistry 2022Quote: ... The scFv gene was then ligated into pCSE2.6-hIgG1-Fc-XP vector (43) using T4 Ligase (Promega) and transformed into E ...