Labshake search
Citations for Promega :
1 - 50 of 936 citations for LAG 3 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Human 26S proteasome purified from HEK293 cells was purchased from Promega. The proteasome chaperoning reaction tests were carried out as follows ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
A rare variant on a common risk haplotype of HFE causes increased risk of hereditary hemochromatosisbioRxiv - Genetics 2019Quote: ... or HEK293 cells using Fugene 6 (Promega) following manufacturer’s instructions and studied 48-72 hours post-transfection.
-
bioRxiv - Developmental Biology 2022Quote: ... and Klf4 vectors were co-transfected with pCL-Eco (Addgene ID 12371)149 in HEK293 cells with FuGENE6 (Promega) using low volume transfection protocol (Steffen et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293 cells were transfected with Fugene 6 (Promega). All other cell lines were transfected using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... into HEK293 using FuGENE 6 transfection reagent (Promega). Culture supernatant containing lentiviral particles was harvested after 24-48h incubation and passed through a 0.45 μm filter ...
-
bioRxiv - Cell Biology 2020Quote: HEK293 autophagy reporter cells (HiBiT-HaloTag-LC3, Promega #GA1040) were grown in in DMEM (ThermoFisher #31053-028 ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 were transiently transfected using Fugene HD (Promega, U.K.) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... HEK293 cells were transiently transfected using Fugene 6 (Promega) with GFP-Tnf 3’UTR reporter constructs and a pGL3-mCherry control construct ...
-
bioRxiv - Molecular Biology 2022Quote: HEK293 cells cotransfected with pFN21A HaloTag CMV Flexi vector (Promega) expressing PALLD and pNLF1-N [CMV Hygro] or pNLF1-C [CMV Hygro] vector (Promaga ...
-
bioRxiv - Cancer Biology 2021Quote: The 3’UTR of human PAQR3 was cloned into pmirGLO vector (Promega, Madison, WI, USA), and then validated by sequencing ...
-
bioRxiv - Cell Biology 2021Quote: HEK293 stably expressing pcDNA3.1(+)_SSF-GCGR cells transfected with GloSensor20F (Promega) were lifted and resuspended in imaging media (DMEM without phenol red supplemented with 30 mM HEPES ...
-
bioRxiv - Systems Biology 2021Quote: ... HEK293 cells were co-transfected using Fugene 6 transfection reagent (Promega) with MAC-tag (600ng ...
-
bioRxiv - Molecular Biology 2020Quote: ... WT or mutant promoter of human Rpl28 gene was cloned into pGL-3-basic (Promega, E1751). The number is relative to transcriptional start site ...
-
bioRxiv - Immunology 2024Quote: ... 3×106 ADCC and ADCP Bioassay Effector Cells expressing the human FcγRIIIa or FcγRIIa receptors (Promega) were added per well and the cells were incubated in at 37°C with 5% CO2 for 6 hours ...
-
bioRxiv - Molecular Biology 2020Quote: HEK293 cells were rinsed and lysed with Passive Lysis Buffer (PBL, Promega), protein concentrations determined using the DC protein assay (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... retroviral plasmid was transfected to HEK293 cells using FuGENE 6 (Promega, E2692). Two days after transfection ...
-
bioRxiv - Molecular Biology 2022Quote: HCT116 cells were transfected using JetPrime(Polyplus) and HEK293 using Fugene (Promega) using a standard protocol ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Plasmid DNAs were transfected into HEK293 cells with ViaFect Transfection Reagent (Promega) according to manufacturer’s instruction.
-
bioRxiv - Physiology 2023Quote: ... whereas HEK293 cells stably expressing a luminescent cAMP GloSensor (GS-293) (Promega) were previously created in our lab 25 ...
-
bioRxiv - Neuroscience 2019Quote: ... HEK293 cells were transfected in the 24 well plates using Fugene HD (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Retrovirus was produced through transfection of HEK293 cells using FuGENE 6 (Promega, E2692). Two days after transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... 25,000 HEK293-T cells were seeded and transfected with FuGENE 6 (#E231A, Promega) and plasmid DNA at the carrier (µL):DNA (µg ...
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2019Quote: ... genomic DNA from puromycin selected cells and wild-type HEK293 cells was extracted (Promega Wizard Genomic DNA Purification Kit #A1120 ...
-
bioRxiv - Neuroscience 2022Quote: HEK293 cells (ATCC, Manassas, VA) stably expressing both D3R and GloSensor 22F-cAMP (Promega) were created for these experiments ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... HEK293 cells were transfected with the VHL-NanoLuc fusion constructs using FuGENE HD (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293-µOR cells were transfected with a plasmid encoding pGloSensor-20F cAMP reporter (Promega). Cells were harvested 24 h post transfection and resuspended at a 1.5x10^6 live cells/ml in assay media (DMEM without phenol red or FluoroBrite DMEM ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 cells were treated for 8 hours with either 0.1 µmoles/L Coumermycin A1 (Promega) or an equivalent volume of DMSO ...
-
bioRxiv - Microbiology 2022Quote: ... HEK293 cells were transfected using FuGeneHD transfection reagent according to manufacturer’s protocol (Promega, Cat # E2311). 48 hours post-transfection ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293 cells were transfected using FuGeneHD transfection reagent according to manufacturer’s protocol (Promega, Cat # E2311). 48 hours post-transfection ...
-
bioRxiv - Biochemistry 2019Quote: HEK293 was used for transfection of plasmids with FuGENE HD Transfection reagent (Promega, Tokyo, Japan). RIPA buffer was used for obtaining proteins from whole cells ...
-
bioRxiv - Immunology 2020Quote: ... expression constructs were transfected into the HEK293 EBNA cells using FuGENE HD transfection reagent (Promega). After selection with puromycin ...
-
bioRxiv - Neuroscience 2023Quote: Plasmid constructs were acutely transfected into HEK293 cells using Viafect reagent (E4981; Promega, Madison, WI), following the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: The short TMEM106B 3’ UTR and the long TMEM106B 3’ UTR were amplified from human genomic DNA (H1) and then cloned into the pmirGLO Dual-Luciferase Vector (Promega, E1330) using Gibson assembly ...
-
bioRxiv - Cancer Biology 2019Quote: ... HEK293 or MIA PaCa-2 cells were transfected with different AGO2 constructs using Fugene HD (Promega) or Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: HEK293 T cells were co-transfected with the target receptor construct and GloSensor cAMP reporter (Promega) in DMEM supplemented with 10% FBS for overnight incubation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified BAC and plasmid DNA were transfected into HEK293 cells with FuGene HD transfection reagent (Promega) in a 1:3 DNA:FuGene HD ratio ...
-
bioRxiv - Cell Biology 2023Quote: HEK293 cells were transfected with β1AR and a cyclic-permuted luciferase reporter construct (pGloSensor-20F, Promega) and luminescence values were measured ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-untranslated region (3’-UTR) fragment of IκBα (human/rat) was inserted into the pGL3-basic vector (firefly luciferase; Promega, Madison, WI, USA), which was obtained from General Biosystems (Anhui ...
-
bioRxiv - Immunology 2021Quote: ... Luciferase activity in infected hACE2-HEK293 cells was measured with a Bright-Glo Luciferase assay system (Promega) and a Beckman Coulter DTX880 plate reader ...
-
bioRxiv - Biophysics 2020Quote: ... Changes in the intracellular cAMP concentration of the HEK293 cells were measured by the GloSensor assay (Promega). The transfected cells were incubated with or without 0.5 μM all-trans-retinal (Toronto Research Chemicals) ...
-
bioRxiv - Biophysics 2021Quote: ... Constructs (2 μg) were transfected into HEK293 cells on glass coverslips using Fugene HD (Promega, Madison, WI) per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK293 cells were washed with 1X PBS buffer and then lysed with 1X passive lysis buffer (Promega). The cells were cleared of any cell debris by centrifugation at 14000 rpm for 10 min at 4°C ...
-
Development of a genetically-encoded sensor for probing endogenous nociceptin opioid peptide releasebioRxiv - Neuroscience 2023Quote: HEK293 cells growing at 70% confluency in a 10 cm dish were transfected with wild-type human NOPR or NOPLight (3 µg DNA) and GloSensor-20F (Promega, 2.5 µg DNA) using 12 µL Lipofectamine 2000 (Thermo Fisher ...
-
bioRxiv - Systems Biology 2023Quote: HEK293 cells stably expressing μOR or μOR-APEX2 were transiently transfected with the cAMP biosensor pGLO-20F (Promega). Prior to agonist stimulation ...
-
bioRxiv - Cell Biology 2022Quote: ... After 3 days Caspase-Glo 3/7 (Promega) and CellTiterGlo (Promega ...