Labshake search
Citations for Promega :
1 - 50 of 263 citations for InP ZnS PEG NH2 Quantum Dots 640 nm since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: ... or 40 mM chloroalkane-PEG-NH2 (Promega P6741) with one volume of 40 mM methacrylate-NHS (Sigma 730300 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Amplicons flanking the targeting site were amplified with the following primers: Inp D447N Fw GCGGTTCTTTAGCACGGTTA and Inp D447N Rev: CTCCTCATCTCCCTCCATG using GoTaq G2 polymerase (Promega). PCR protocol ...
-
bioRxiv - Microbiology 2023Quote: ... PEG-8000 (Promega) was added to the filtrate to a final concentration of 10% ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4% PEG-8000 (Promega), 2% FBS (Biosera) ...
-
bioRxiv - Neuroscience 2024Quote: ... Supernatant was concentrated using PEG precipitation with 1 volume of PEG concentrator for every 3 volumes of supernatant (PEG concentrator: 40% (w/v) PEG 8000 (Promega, V3011) in 1× PBS (Thermo ...
-
bioRxiv - Biochemistry 2023Quote: HaloTag-PEG-biotin ligand (Promega, cat ...
-
bioRxiv - Immunology 2024Quote: ... 7.5% PEG-8000 (Promega, #V3011), 2 U/µL Maxima H-minus reverse transcriptase ...
-
bioRxiv - Cell Biology 2024Quote: ... 4% PEG 8000 (Promega, V3011), 5 mM NaCl ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.4 μl of each normalized sample was mixed with 1.2 μl of Tn5 Tagmentation mix (0.64 μl TAPS-PEG buffer (PEG 8000, V3011, PROMEGA, and TAPS-NaOH pH8.5 ...
-
bioRxiv - Microbiology 2022Quote: ... concentrated by polyethylene glycol (PEG, Promega, Austria) precipitation ...
-
bioRxiv - Systems Biology 2024Quote: ... we incorporated polyethylene glycol (PEG 8000; Promega) at a concentration of 10% w/v in each reaction ...
-
bioRxiv - Bioengineering 2023Quote: ... The AAV production media were collected 72 h and 120 h post transfection and concentrated using a PEG-precipitation method with 8% PEG-8000 (wt/vol; Cat# V3011, Promega). The harvested cell pellets were re-suspended and lysed through sonication ...
-
bioRxiv - Developmental Biology 2020Quote: ... HaloTag® PEG-Biotin Ligand (Promega Corporation, G8591) was added to pre-cleared 6His-Halo-MBP PRDM9 to 1 μM final concentration and the mixture was incubated 2 hrs at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µM HaloTag PEG-biotin ligand (G859A; Promega) or an equivalent amount of DMSO was added ...
-
bioRxiv - Genetics 2020Quote: ... The 10 µL Zn-finger PCR reaction was prepared containing of 2 µL of 5X reaction buffer (Promega), 0.8 µL of 2.0 mM MgCl2 ...
-
bioRxiv - Genomics 2024Quote: ... before pooling and concentrating with PEG-8,000 (#V3011, Promega). Aliquots of concentrated lentivirus were stored at −80 °C until used ...
-
bioRxiv - Genetics 2024Quote: ... Virus was concentrated using PEG virus precipitation (Promega # V3011). In brief ...
-
bioRxiv - Cell Biology 2023Quote: ... The APTES-coated coverslip was assembled into a flow channel and NH2-O4-Halotag ligand (Promega) was immobilized on to the coverslip through glutaraldehyde (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... a mix was prepared consisting of 5 % PEG-8000 (Promega), 100 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PEG-precipitated phagemid was then treated with DNaseI (Promega) for 1 h at 37° C to remove any contaminating bacterial DNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 15°C in the presence of 27% PEG 8000 (Promega) to minimize ligation sequence bias ...
-
bioRxiv - Cell Biology 2024Quote: ... PEG 8000 (Polyethylene glycol 8000) was purchased from Promega (Catalog #: V3011). Amine-reactive PEG (mPEG-succinimidyl valerate MW 5000 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and polyethylene glycol solution concentrate was added (5X concentrate: PEG 8000 MW Promega, V3011 ...
-
bioRxiv - Biophysics 2022Quote: ... The purified Kif5B protein was incubated with 10 µM HaloTag PEG-Biotin ligand (Promega) for 30 min on ice to produce a final construct of Kif5B homodimer with two C-terminal biotin tags ...
-
bioRxiv - Immunology 2021Quote: ... RBD and NTD antigens were site-specifically biotinylated using Halotag PEG biotin ligand (Promega), following the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2024Quote: ... A notable modification from the original protocol was the inclusion of polyethylene glycol (PEG 8000; Promega) at a concentration of 10% w/v per reaction ...
-
bioRxiv - Biophysics 2023Quote: ... coverslips were plasma-cleaned followed by coating with 10% polyethylene glycol (PEG-8000, Promega, Madison, WI). 100 autocorrelation curves ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 mL of the filtrate was transferred to tubes containing polyethylene glycol (PEG-8000, Promega) to achieve the final PEG concentration of 10% ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 100 nM bafilomycin A1 and 37.5 nM TMRDirect Halo Ligand (Promega). After 2 hours in EBSS ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 nM streptavidin (Promega) was included in the master mix ...
-
bioRxiv - Immunology 2022Quote: ... filtered through 0.22 μm filter and precipitated using 40% (W/V) PEG-8000 (Promega, catalog no. V3011) and 1.2M NaCl (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... the bead-bound protein was incubated with either 6.7 μM HaloTag-TMR or HaloTag-PEG-biotin ligand (Promega) for 15 minutes at room temperature ...
-
bioRxiv - Bioengineering 2020Quote: ... Trypsin gold (100 nM; Promega) was added to each sample and proteolysis proceeded for 2 h at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.05 nM JF549 (GA1110; Promega) dye was mixed with 10 nM JF646 dye (GA1120 ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 mM NaCl2 or 16% PEG and assayed for luciferase activity using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... and 100 nM of luciferin (Promega) at 36.5°C ...
-
bioRxiv - Cell Biology 2023Quote: ... and 200 nM JF646 ligand (Promega) was added 15 min prior to imaging ...
-
bioRxiv - Synthetic Biology 2024Quote: ... or 17.6 nM of FFz (Promega). Images were analyzed using Living Image (Perkin Elmer).
-
bioRxiv - Molecular Biology 2024Quote: ... The phase separation assay was performed in the presence or absence of 10% polyethylene glycol 8000 (PEG-8000, Promega, V3011) and the reaction mix loaded in a home-made imaging chamber consisting of a glass slide attached to a cover slip by two parallel strips of double-sided tape ...
-
bioRxiv - Cell Biology 2024Quote: ... and lentiviral-containing supernatant was tested for mycoplasma contamination and then concentrated in 50% polyethylene glycol (PEG) 8000 (Promega V3011) for at least 72h at 4°C ...
-
bioRxiv - Biophysics 2023Quote: 5 μM purified EGFP-YbbR-Lphn3 GAIN-HaloTag protein in HBS was mixed with 5.2 μM HaloTag PEG-Biotin Ligand (Promega, G8592) and incubated at room temperature for 2 hours to biotinylate the CTF of the GAIN construct ...
-
bioRxiv - Microbiology 2024Quote: ... Purified DENV2 EDIII was biotinylated by incubating 100 µg of DENV2 EDIII with 5 nmol of the HaloTag PEG biotin ligand (Promega) at room temperature (RT ...
-
bioRxiv - Biochemistry 2024Quote: The in vitro LLPS of all proteins was performed either in presence of varying concentrations of PEG-8000 (v/v) (Promega) or without any crowding agent in a dilution buffer composed of 50mM Tris pH 8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Retroviral particles released from the packaging cells were collected 48 hrs post-transfection and concentrated using PEG-8000 (V3011, Promega), and then used to infect M2 cells in the presence of 10 µg/ml polybrene ...
-
bioRxiv - Cell Biology 2024Quote: ... After PCR pre-amplified cDNA were clean-up using 22% home-made PEG beads at a ratio of 0.7 beads:1 sample before concentration quantification using QuantiFluor® dsDNA System (Promega, #E2671). cDNA was normalised and diluted to 100pg µl-1.
-
bioRxiv - Neuroscience 2020Quote: ... Fluorescence was measured at 620 nm excitation and 680 nm emission using a Glomax Explorer Microplate Reader (Promega).
-
bioRxiv - Cancer Biology 2024Quote: ... donor emission (460 nm) and acceptor emission (618 nm) signals were measured using the GloMax Discover System (Promega). Raw NanoBRET™ ratio values with milliBRET units (mBU ...
-
bioRxiv - Molecular Biology 2024Quote: ... and measuring fluorescence (excitation: 560 nm, emission: 590 nm) or by using the CellTiter-Glo dye (Promega, G9242) and measuring luminescence ...
-
bioRxiv - Genetics 2022Quote: ... 100 nM of HaloTag-618 dye (Promega) was added to the cells 24-hrs before BRET measurement ...
-
bioRxiv - Developmental Biology 2023Quote: ... or OregonGreen ligand (50 nM; Promega, #G2801) or no HaloTag dye ...