Labshake search
Citations for Promega :
1 - 50 of 2674 citations for IL 1 Alpha Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Lumit Human IL-1β Immunoassay (Promega) was performed according to manufacturer instructions ...
-
bioRxiv - Microbiology 2021Quote: ... knowlesi elongation factor-1 alpha (pkef1-alpha) 5’ UTR were isolated from agarose gels and cloned into the pGEM-T vector (Promega, Madison, WI, USA). To replace the pfcam 5’ UTR sequence that drives luciferase transcription in the pD-pfcam-Luc ...
-
bioRxiv - Genomics 2023Quote: ... 1 ug human DNA (Promega, Madison, WI), 5 ug sheared salmon sperm DNA (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... Bovine alpha-2-hs-glycoprotein was isolated from plasma (Fetuin, Promega, V4961), and monocyte differentiation antigen CD14 was recombinantly expressed in CHO cells (R&D systems ...
-
bioRxiv - Cancer Biology 2020Quote: ... Triplicate biological replicates were digested with Lys-C (Alpha Laboratories) and trypsin (Promega) on beads as previously described68 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quadruplicate biological replicates were digested with Lys-C (Alpha Laboratories) and trypsin (Promega) on beads as previously described 60 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pellets were reconstituted and digested with endoproteinase Lys-C (Alpha Laboratories, UK) for 1 hour at room temperature and trypsin (Promega, Madison, WI, USA) overnight at 35°C.
-
bioRxiv - Cell Biology 2024Quote: ... biological replicates (n=7) were digested with Lys-C (Alpha Laboratories) and trypsin (Promega) on beads as previously described (Hubner et al. ...
-
bioRxiv - Genomics 2022Quote: ... diluted to 1% in purified human genomic DNA (Promega, female, catalog No. G1521). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... Three biological replicates for each condition were digested with Lys-C (Alpha Laboratories) and trypsin (Promega) “on beads” as previously described [44] ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... we used a 1/1500 artificial mix of promastigote DNA and human DNA (Promega) to reflect the median ratio found in clinical samples ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biological triplicates were digested with Lys-C (Alpha Laboratories, Eastleigh, UK) and trypsin (Promega, Madison, WI, USA) on beads as previously described (56) ...
-
bioRxiv - Immunology 2020Quote: ... pCAG-Flag or pCMV-HA-N expression vectors using standard molecular cloning methods as described in our previous publications.30–32 The IFN-β luciferase reporter plasmid pGL3-IFN-β-Luc vector was constructed in our previous study.33,34 The IFNλ1 luciferase reporter plasmid pGL3-IFNλ1-Luc was constructed by inserting the 1000-bp promoter region of human IFNλ1 (nucleotides −1000 to +1, with the translation start site set as 1) into pGL3-Basic (Promega, USA) according to methods outlined in previous studies.13,34 The ISG luciferase reporter plasmid pISRE-Luc vector was purchased from Clontech (USA) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5ng ml-1 recombinant human fibroblast growth factor (rhFGF) (Promega, Cat#G5071, Madison, WI, USA), and 1% chicken embryonic extract (Seralab ...
-
bioRxiv - Bioengineering 2020Quote: ... Unstimulated media (+CTRL) contained complete α-MEM medium only and stimulated media (+IL-1β) contained 20 ng/mL IL-1β (FHC05510, Promega, Madison, WI, USA) in complete α-MEM medium ...
-
bioRxiv - Systems Biology 2020Quote: ... Human cell lysate (MS Compatible Human Protein Extract, Digest, V6951) were purchased from Promega.
-
bioRxiv - Neuroscience 2020Quote: ... All designed probes were tested by ddPCR using human genomic DNA (Human male, Promega) as a negative control ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were co-transfected in a 1:1 ratio with either human D1 or D2Long receptor and a split-luciferase based cAMP biosensor (GloSensor, Promega, Durham NC). The next day ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human Genomic DNA (G1521, Promega) was used as positive control and synthetic DNA was used to validate the LAMP assay performance ...
-
bioRxiv - Microbiology 2020Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and digested separately overnight using trypsin chymotrypsin or alpha lytic protease (Mass Spectrometry Grade, Promega) at a ratio of 1:30 (w/w) ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 bacterial artificial chromosome and human genome Promega #G1471). Absolute copy number of genomic stocks was determined using droplet digital PCR (Biorad QX600) ...
-
bioRxiv - Microbiology 2020Quote: ... 500 ng human genomic DNA (Promega) or 5 μl of untreated or RNase-treated nasal swab nucleic acid isolates ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pooled human male genomic DNA (Promega) was randomly sheared (500-800bp ...
-
bioRxiv - Systems Biology 2021Quote: ... a human cDNA pool (Promega Corporation), or obtained as synthesized double-stranded DNA fragments (gBlocks ...
-
bioRxiv - Genomics 2021Quote: ... 50ng human genomic DNA (Promega, G304A), 2µM assembled T7-Tn5 transposase or Tn5 transposase was incubated at 55 °C for 7minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... human Female genomic DNA (Promega #G1521), as a reference ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Promega, Madison, WI, USA) was diluted to 10,000 genome copies per μl then serially diluted to 10 genome copies per μl and used to create a human DNA copy number standard curve ...
-
bioRxiv - Molecular Biology 2019Quote: ... The natural templates include purified human (Promega), rhesus monkey (BioChain) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10.0 ng/ml recombinant human FGF (Promega) and 1.0 μM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human Genomic DNA Male (Promega, cat # G1471) and IDH1 R132H Reference Standard (Horizon ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50ng of normal human genomic DNA (Promega) was used as a negative control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human LAMA1 cDNA was purchased from Promega and sub-cloned into pLVX-Tet-On Advanced vector (Clontech) ...
-
bioRxiv - Genomics 2021Quote: Commercial human DNA (Promega, Cat. No. G1521) was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... These included 5μg/ml human gDNA (Promega), 500ng/ml citrullinated histones (Cayman Chemical #501620) ...
-
bioRxiv - Microbiology 2023Quote: ... Human gDNA (Promega, San Luis Obispo, CA) was added to the extracted gDNA from the clinical swabs to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2024Quote: ... a K562 human peptide digest standard (Promega) and E.coli peptide standard (Waters ...
-
bioRxiv - Genomics 2023Quote: ... Human male genomic DNA (Promega, CAT #G1471) was used for a standard curve at 125 pg/µL ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2020Quote: ... The lysate obtained from each tumour sample was mixed at 1:1 ratio with the super-SILAC standard prior to FASP digestion41 with Endoproteinase Lys-C (Alpha Laboratories, UK) and trypsin (Promega, Madison, WI, USA).
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... bulked to 200ng using human genomic DNA (Promega). All samples were sheared for 150 seconds using a Covaris E220 (Duty Factor 5% ...
-
bioRxiv - Systems Biology 2020Quote: The Human cell lysate was obtained commercially (Promega) and the yeast digest was prepared as previously described23 ...
-
bioRxiv - Genomics 2019Quote: ... We added 4μl pooled commercial human gDNA (Promega) to all samples to ensure total gDNA > 1μg/35μl ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... Human GSK-3β was purchased from Promega (V1991).
-
bioRxiv - Genomics 2020Quote: ... and human gDNA (Promega, San Luis Obispo, CA) was added to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2021Quote: ... and SETD2 human ORF were procured from Promega. Deletion mutants of hnRNP L ...